@ARTICLE{TreeBASE2Ref25612,
author = {Melvin R Duvall and Amanda E. Fisher and J. Travis Columbus and Amanda L. Ingram and William P. Wysocki and Sean Vincent Burke and Lynn Clark and Scot A. Kelchner},
title = {Phylogenomics and plastome evolution of the chloridoid grasses (Chloridoideae; Poaceae)},
year = {2016},
keywords = {Poaceae, full plastome, Chloridoideae},
doi = {10.1086/684526},
url = {http://},
pmid = {},
journal = {International Journal of Plant Sciences},
volume = {177},
number = {3},
pages = {},
abstract = {Premise of research. Studies of complete plastomes have proven informative for our understanding of the
molecular evolution and phylogenomics of grasses, but subfamily Chloridoideae has not been included in this
research. In previous multilocus studies, specific deep branches, as in the large clade corresponding to Cyno-
donteae, are not uniformly well supported.
Methodology. In this study, a plastome phylogenomic analysis sampled 14 species representing 4 tribes
and 10 genera of Chloridoideae. One species was Sanger sequenced, and 14 other species, including out-
groups, were sequenced with next-generation sequencing-by-synthesis methods. Plastomes from next-generation
sequences were assembled by de novo methods, and the unambiguously aligned coding and noncoding se-
quences of the entire plastomes were analyzed phylogenetically.
Pivotal results. Chloridoid plastomes showed rare genomic changes in Distichlis, Centropodia, and
Eragrostis tef that were of potential phylogenomic significance. Phylogenomic analyses showed uniformly
strong support for all ingroup relationships except one node in Cynodonteae in which a short internal branch
connected long terminal branches. Resolution within this clade was found to be taxon dependent and possibly
subject to long-branch attraction artifacts.
Conclusions. Our study indicates that the increase in phylogenetic information in sequences of entire
plastomes well resolves and strongly supports relationships among tribes and genera of chloridoid grasses.
Sampling more species, especially in the Centropodia + Ellisochloa clade and Cynodonteae, will further ad-
dress relationships in these groups and clarify the evolutionary origins of the subfamily.}
}
Matrix 41111 of Study 18944

Citation title:
"Phylogenomics and plastome evolution of the chloridoid grasses (Chloridoideae; Poaceae)".

Study name:
"Phylogenomics and plastome evolution of the chloridoid grasses (Chloridoideae; Poaceae)".

This study is part of submission 18944
(Status: Published).
Matrices
Title: 19b Matrix
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Homonota andicola LJAMMCNP12490 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota andicola LJAMMCNP12495 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota borellii LJAMMCNP12116 |
(none)
|
?????????????????????????????? |
Homonota borellii LJAMMCNP12125 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota darwinii LJAMMCNP11432 |
(none)
|
?????????????????????????????? |
Homonota darwinii LJAMMCNP9266 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota spa LJAMMCNP10577 |
(none)
|
?????????????????????????????? |
Homonota spa LJAMMCNP5047 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota rupicola RUPI1 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota rupicola RUPI2 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota spb MNHNP11406 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota spb MNHNP11409 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota taragui LJAMMCNP14419 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota taragui LJAMMCNP14420 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota uruguayensis UFRGS1568 |
(none)
|
?????????????????????????????? |
Homonota uruguayensis UFRGS2579 |
(none)
|
?????????????????????????????? |
Homonota underwoodi LJAMMCNP10923 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota underwoodi LJAMMCNP10931 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota whitii LJAMMCNP12111 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota williamsii LJAMMCNP4467 |
(none)
|
TAAGAAAAGAGAAGGCAATTCATTTCTGTT |
Homonota williamsii LJAMMCNP6517 |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.