@ARTICLE{TreeBASE2Ref25776,
author = {Enrico Ercole and Samuele Voyron and Stefano Ghignone and Silvia Perotto and Mariangela Girlanda},
title = {Fine-scale spatial distribution of orchid mycorrhizal fungi in the soil of host-rich grasslands},
year = {2016},
keywords = {Fungal communities, Tulasnellaceae, Tulasnella calospora, Ceratobasidiaceae, Sebacinales, Pezizaceae, Orchidaceae},
doi = {},
url = {http://},
pmid = {},
journal = {New Phytologist},
volume = {},
number = {},
pages = {},
abstract = {● Mycorrhizal fungi are essential for the survival of orchid seedlings under natural conditions. The distribution of these fungi in soil can constrain the establishment and resulting spatial arrangement of orchids at the local scale, but the actual extent of occurrence and spatial patterns of orchid mycorrhizal (OrM) fungi in soil remain largely unknown.
● We addressed the fine-scale spatial distribution of OrM fungi in two orchid-rich Mediterranean grasslands by means of high-throughput sequencing of fungal ITS2 amplicons, obtained from soil samples collected either directly beneath, or at a distance from, adult Anacamptis morio and Ophrys sphegodes plants.
● Like ectomycorrhizal and arbuscular mycobionts, OrM fungi (tulasnelloid, ceratobasidioid, sebacinoid and pezizacean fungi) exhibited significant horizontal spatial autocorrelation in soil. However, OrM fungal read numbers did not correlate with distance from adult orchid plants, and several of these fungi were extremely sporadic or undetected even in the soil samples hcontaining the orchid roots.
● The sporadic occurrence of mycobionts of grassland orchids in host-rich stands uestions the view of these fungi as capable of sustained growth in soil.}
}
Matrix 57107 of Study 19171

Citation title:
"Fine-scale spatial distribution of orchid mycorrhizal fungi in the soil of host-rich grasslands".

Study name:
"Fine-scale spatial distribution of orchid mycorrhizal fungi in the soil of host-rich grasslands".

This study is part of submission 19171
(Status: Published).
Matrices
Title: Mortierella 5
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Mortierella ambigua JX976067 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella ambigua JX976062 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella capitata JX976008 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella wolfii HQ630305 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella wolfii HQ630304 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella microzygospora HQ630317 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella pseudozygospora JX975880 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella sp. OTU 1256 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella parazychae HQ630283 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella rostafinskii HQ630358 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAGA |
| Mortierella strangulata HQ630359 |
(none)
|
CGAAATGCGATACGTAATGTGAATTGCAAA |
Columns
None of the columns has a description.