@ARTICLE{TreeBASE2Ref16000,
author = {Shuguang Jian and Pamela S. Soltis and Matthew A. Gitzendanner and Michael J. Moore and Ruiqi Li and Tory A. Hendry and Y. L. Qiu and Amit Dhingra and Charles D. Bell and Douglas E. Soltis},
title = {Resolving an ancient, rapid radiation in Saxifragales.},
year = {2008},
keywords = {},
doi = {10.1080/10635150801888871},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {57},
number = {1},
pages = {38--57},
abstract = {Despite the prior use of ~ 9,000 bp, deep-level relationships within the angiosperm clade Saxifragales remain enigmatic, due to an ancient, rapid radiation (89.5 -110 Myr based on the fossil record). To resolve these deep relationships, we constructed several new data sets: 1) 16 genes representing the three genomic compartments within plant cells (two nuclear, ten plastid, four mitochondrial; aligned, analyzed length = 21,460 bp) for 28 taxa; 2) the entire plastid inverted repeat (IR; 26,625 bp) for 17 taxa; 3) ?total evidence? (50,845 bp) for both 17 and 28 taxa (the latter missing the IR). Bayesian and ML methods yielded identical topologies across partitions with most clades receiving high posterior probability (pp = 1.0) and bootstrap (95-100%) values, suggesting that with sufficient data, rapid radiations can be resolved. In contrast, parsimony analyses of different partitions yielded conflicting topologies, particularly with respect to the placement of Paeoniaceae, a clade characterized by a long branch. In agreement with published simulations, the addition of characters increased bootstrap support for the putatively erroneous placement of Paeoniaceae. Although having far fewer parsimony-informative sites, slowly-evolving plastid genes provided higher resolution and support for deep-level relationships than rapidly evolving plastid genes, yielding a topology close to the Bayesian and ML total evidence tree. The plastid IR region may be an ideal source of slowly evolving genes for resolution of deep-level angiosperm divergences that date to 90 my or more. Rapidly evolving genes provided support for tip relationships not recovered with slowly evolving genes, indicating some complementarity. Age estimates using penalized likelihood with and without age constraints for the 28-taxon, total evidence data set are comparable to fossil dates, whereas estimates based on the 17-taxon data are much older than implied by the fossil record. Hence, sufficient taxon density, and not simply numerous base pairs, is important in reliably estimating ages. Age estimates indicate that the early diversification of Saxifragales occurred rapidly, over a timespan as short as 6 million years. Between 25,000 ? 50,000 bp were needed to resolve this radiation with high support values. Extrapolating from Saxifragales, a similar number of base pairs may be needed to resolve the many other deep-level radiations of comparable age in angiosperms.}
}
Matrix 2921 of Study 1923

Citation title:
"Resolving an ancient, rapid radiation in Saxifragales.".

This study was previously identified under the legacy study ID S1902
(Status: Published).
Matrices
Title: Sax 2
Description: Legacy TreeBASE Matrix ID = M3492
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Vitis |
(none)
|
TGCATTGGAGTACCGATGTGTACCATGCAC |
| Trochodendron |
(none)
|
?????????????????????????????? |
| Tetracarpaea |
(none)
|
?????????????????????????????? |
| Sedum |
(none)
|
???ACTGGAGTACCAATGTGTACCATGCAT |
| Saxifraga |
(none)
|
?????????????????????????????? |
| Micranthes |
(none)
|
?????????????????????????????? |
| Ribes |
(none)
|
???ACTGGAGTACCGATGTGTACCATGCAC |
| Rhodoleia |
(none)
|
?????????????????????????????? |
| Pterostemon |
(none)
|
???ACTGGAGTACCGATGTGTACCATGCAC |
| Platanus |
(none)
|
??CACTGGAGTACCAATGTGTACCATGCGC |
| Peridiscus |
(none)
|
?????????????????????????????? |
| Penthorum |
(none)
|
??CACTGGAGTACCGATGTGTACCATGCAC |
| Paeonia |
(none)
|
TGCACTGGAGTACTGATGTATACCATGCAC |
| Myriophyllum |
(none)
|
???ACTGGAGTACTGATGTGTACCATGCAC |
| Liquidambar |
(none)
|
?????????????????????????????? |
| Kalanchoe |
(none)
|
?????????????????????????????? |
| Itea |
(none)
|
???ACTGGAGTACCGATGTGTACCATGCAA |
| Heuchera |
(none)
|
?????????????????????????????? |
| Hamamelis |
(none)
|
??CACTGGAGTACCGATGTGTACCATGCGC |
| Haloragis |
(none)
|
???ACTGGAGTACCGATGTGTACCATGCAC |
| Exbucklandia |
(none)
|
?????????????????????????????? |
| Daphniphyllum |
(none)
|
?????????????????????????????? |
| Crassula |
(none)
|
???ACTGGAGTACCAATGTGTACCATGCAT |
| Corylopsis |
(none)
|
?????????????????????????????? |
| Choristylis |
(none)
|
?????????????????????????????? |
| Cercidiphyllum |
(none)
|
??CACTGGAGTACCGATGTGTACCATGCAC |
| Aphanopetalum |
(none)
|
???ACTGGAGTACCGACGTGTACCACGCGC |
| Altingia |
(none)
|
??CACTGGAGTACCGATGTGTATCATGCAC |
Columns
None of the columns has a description.