CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 2927 of Study 1925

About Citation title: "Phylogenetic study of clavicipitaceous fungi using acetaldehyde dehydrogenase gene sequences".
About This study was previously identified under the legacy study ID S1904 (Status: Published).

Matrices

Title: ALDH1-1 Exon-3

Description: Legacy TreeBASE Matrix ID = M3498

Rows

Taxon Label Row Segments Characters 1–30
Gibberella zeae 2  (none) ATCGGTGTCTGCGGTCAGATTATCCCCTGG
Heteroepichloe bambusae  (none) ATTGGCGTCTGCGGTCAAATAATCCCGTGG
Heteroepichloe sasae  (none) ATTGGCGTTTGCGGTCAAATCATCCCGTGG
Parepichloe cinerea  (none) ATTGGTGTTTGCGGTCAAATCATCCCGTGG
Ephelis japonica4  (none) ATTGGTGTTTGCGGTCAGATTATCCCGTGG
Ephelis japonica1  (none) ATTGGTGTTTGCGGTCAGATTATCCCGTGG
Neotyphodium  (none) ATTGGTGTTTGCGGTCAGATCATCCCCTGG
Epichloe typhina  (none) ATTGGTGTTTGCGGTCAGATCATCCCCTGG
Neurospora crassa1  (none) CTCGGTGTTTGCGGTCAGATCATCCCCTGG
Nomuraea atypicola  (none) ATTGGTGTCTGTGGTCAGATTATTCCCTGG
Cordyceps militaris2  (none) ATTGGTGTCTGCGGTCAGATCATTCCCTGG
Cordyceps militaris1  (none) ATTGGTGTCTGCGGTCAGATCATTCCCTGG
Cordyceps heteropoda  (none) GTGGGCGTCTGCGGTCAAATCATCCCCTGG
Cordyceps paradoxa  (none) ATTGGTGTCTGCGGCCAGATCATTCCCTGG
Cordyceps ophioglossoides  (none) CTCGGTGTCTGCGGTCAGATCATTCCCTGG
Ustilaginoidea virens Japan  (none) ATTGGTGTTTGCGGCCAAATCATTCCCTGG
Ustilaginoidea virens China  (none) CTTGGTGTTTGCGGCCAAATCATTCCCTGG
Aciculodporium take 2  (none) CTTGGTGTCTGCGGTCAAATCATACCCTGG
Aciculodporium take 1  (none) CTTGGTGTCTGCGGTCAAATCATACCCTGG
Claviceps purpurea Japan  (none) CTTGGTGTCTGCGGCCAAATTATTCCCTGG
Claviceps purpurea China  (none) CTTGGTGTCTGCGGCCAAATCATTCCCTGG

Columns

None of the columns has a description.