@ARTICLE{TreeBASE2Ref25898,
author = {Gustavo Mateus Silva and Ricardo Magela Souza and Lichun Yan and Rui Sales Junior and Flavio H.V. Medeiros and Ron R. Walcott},
title = {Strains of the Group I lineage of Acidovorax citrulli, the causal agent of bacterial fruit blotch of cucurbitaceous crops, are predominant in Brazil.},
year = {2016},
keywords = {},
doi = {},
url = {http://},
pmid = {},
journal = {Phytopathology},
volume = {},
number = {},
pages = {},
abstract = {Bacterial fruit blotch (BFB), caused by the seedborne bacterium Acidovorax citrulli, is an economically important threat to cucurbitaceous crops worldwide. Since the first report of BFB in Brazil in 1990, outbreaks have occurred sporadically on watermelon, and more frequently on melon, resulting in significant yield losses. At present, the genetic diversity and the population structure of A. citrulli strains in Brazil remain unclear. A collection of 74 A. citrulli strains isolated from naturally infected fruits of different hosts in Brazil between 2000 and 2014 and 18 A. citrulli reference strains from other countries were compared by pulsed-field gel electrophoresis (PFGE), multilocus sequence analysis (MLSA) of housekeeping and virulence-associated genes and pathogenicity tests on different cucurbit seedling hosts. The Brazilian population was comprised predominantly of group I strains (98%), regardless of the year of isolation, geographical region or host. Whole genome restriction digestion and PFGE analysis revealed that three unique and previously unreported A. citrulli haplotypes (assigned as haplotypes B22, B23 and B24) occurred in Brazil. The greatest diversity of A. citrulli (4 haplotypes) was found among strains collected from the Northeastern region of Brazil, which accounts for more than 90% of the country`s melon production. MLSA clearly distinguished A. citrulli strains into two well supported clades, in agreement with observations based on PFGE analysis. Five Brazilian A. citrulli strains, representing different group I haplotypes, were moderately aggressive on watermelon seedlings compared to four group II strains that were highly aggressive. In contrast, no significant differences in BFB severity were observed between group I and II A. citrulli strains on melon and squash seedlings. Finally, we observed a differential effect of temperature on in vitro growth of representative group I and II A. citrulli haplotypes. Specifically, out of 18 group II strains tested, all grew at 40?C and 41?C. On the other hand, only three group I strains [haplotypes B8 (P), B3 (K) and B15] out of 15 grew at 40?C. Three strains representing haplotype B8 (P) were the only group I strains that grew at 41?C. These results contribute to a better understanding of the genetic diversity of A. citrulli associated with BFB outbreaks in Brazil, and reinforce the efficiency of MLSA and PFGE analysis for assessing population structure. This study also provides the first evidence to suggest that temperature might be a driver in the ecological adaptation of A. citrulli populations. }
}
Matrix 36552 of Study 19309

Citation title:
"Strains of the Group I lineage of Acidovorax citrulli, the causal agent of bacterial fruit blotch of cucurbitaceous crops, are predominant in Brazil.".

Study name:
"Strains of the Group I lineage of Acidovorax citrulli, the causal agent of bacterial fruit blotch of cucurbitaceous crops, are predominant in Brazil.".

This study is part of submission 19309
(Status: Published).
Matrices
Title: Acidovorax citrulli Matrix pilT
Description: DNA sequence pilT gene
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Acidovorax citrulli AAC 213 49 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 41 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 42 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 44 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 45 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 47 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 48 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AC 05 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 61 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 60 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 59 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 58 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 55 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 54 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 53 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 52 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 51 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AAC 213 50 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax citrulli AC 50 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
| Acidovorax avenae NC 015138 |
(none)
|
TCCGCGTGCATGGCGACGTGCGCCGCATCA |
Columns
None of the columns has a description.