@ARTICLE{TreeBASE2Ref25966,
author = {Giovanna Linguiti and Rachele Antonacci and Gianluca Tasco and Francesco Grande and Rita Casadio and Serafina Massari and Vito Castelli and Arianna Consiglio and Marie-Paule Lefranc and Salvatrice Ciccarese},
title = {Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human},
year = {2016},
keywords = {T cell receptor, TRG locus, TRGV, TRGJ and TRGC genes, TRA/TRD locus, TRAV and TRDV genes, dolphin genome, expression analysis, IMGT},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Genomics},
volume = {},
number = {},
pages = {},
abstract = {Background
The bottlenose dolphin (Tursiops truncatus) is a mammal that belongs to the Cetartiodactyla and have lived in marine ecosystems for nearly 60 millions years. Despite its popularity, our knowledge about its adaptive immunity and evolution is very limited. Furthermore, nothing is known about the genomics and evolution of dolphin antigen receptor immunity.
Results
Here we report a evolutionary and expression study of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) genes. We have identified in silico the TRG and TRA/TRD genes and analyzed the relevant mature transcripts in blood and in skin from four subjects.
The dolphin TRG locus is the smallest and simplest of all mammalian loci as yet studied. It shows a genomic organization comprising two variable (V1 and V2), three joining (J1, J2 and J3) and a single constant (C), genes. Despite the fragmented nature of the genome assemblies, we deduced the TRA/TRD locus organization, with the recent TRDV1 subgroup genes duplications, as it is expected in artiodactyls.
Expression analysis from blood of a subject allowed us to assign unambiguously eight TRAV genes to those annotated in the genomic sequence and to twelve new genes, belonging to five different subgroups. All transcripts were productive and no relevant biases towards TRAV-J rearrangements are observed.
Blood and skin from four unrelated subjects expression data provide evidence for an unusual ratio of productive/unproductive transcripts which arise from the TRG V-J gene rearrangement and for a ?public? gamma delta TR repertoire. The productive cDNA sequences, shared both in the same and in different individuals, include biases of the TRGV1 and TRGJ2 genes.
The high frequency of TRGV1-J2/TRDV1- D1-J4 productive rearrangements in dolphins may represent an interesting oligo-clonal population comparable to that found in human with the TRGV9- JP/TRDV2-D-J T cells and in primates.
Conclusions
Although the features of the TRG and TRA/TRD loci organization reflect those of the so far examined artiodactyls, genomic results highlight in dolphin an unusually simple TRG locus. The cDNA analysis reveal productive TRA/TRD transcripts and unusual ratios of productive/unproductive TRG transcripts. Comparing multiple different individuals, evidence is found for a ?public? gamma delta TCR repertoire thus suggesting that in dolphins as in human the gamma delta TCR repertoire is accompanied by selection for public gamma chain.
}
}
Matrix 36815 of Study 19396

Citation title:
"Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human".

Study name:
"Genomic and expression analyses of Tursiops truncatus T cell receptor gamma (TRG) and alpha/delta (TRA/TRD) loci reveal a similar basic public γδ repertoire in dolphin and human".

This study is part of submission 19396
(Status: Published).
Matrices
Title: Tursiops truncatus 15 al J2
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Ovis aries TRGJ6 2 F |
(none)
|
------------GAATTTAAACTACATGAT |
Ovis aries TRGJ3 2 P |
(none)
|
------------AAATTATTATAGAAAAAT |
Ovis aries TRGJ4 2 F |
(none)
|
------------TAATAGTTACATAAAAAA |
Ovis aries TRGJ1 2 F |
(none)
|
------------GAATGATTACATAAAAAA |
Ovis aries TRGJ2 2 F |
(none)
|
------------GAATAATTACATAAAAAA |
Ovis aries TRGJ5 3 F |
(none)
|
------------GAGTTATTATGTAAAAAT |
Tursiops truncatus TRGJ3 F |
(none)
|
------------GAGTTATTACATAAAAAT |
Homo sapiens TRGJ1 F |
(none)
|
------------GAATTATTATAAGAAACT |
Homo sapiens TRGJ2 F |
(none)
|
------------GAATTATTATAAGAAACT |
Camelus dromedarius TRGJ2 2 F |
(none)
|
------------GAATTA-TATAATAAAAT |
Tursiops truncatus TRGJ2 F |
(none)
|
--GGCTAACACATGGCAAGAGCGTCAAAGT |
Ovis aries TRGJ5 2 P |
(none)
|
--TGCAAACAGGTGGCCAGAGCATCGAAGT |
Homo sapiens TRGJP F |
(none)
|
TGGGCAAGAGTTGGGCAAAAAAATCAAGGT |
Camelus dromedarius TRGJ2 1 ORF |
(none)
|
-GGGCTGCAAAAGGGGC--TGGAGGAAGAT |
Homo sapiens TRGJP2 F |
(none)
|
------ATAGTAGTGAT--TGGATCAAGAC |
Homo sapiens TRGJP1 F |
(none)
|
------ATACCACTGGT--TGGTTCAAGAT |
Ovis aries TRGJ1 1 F |
(none)
|
------ACAGCGAGGGC--TGGAAGAAGAT |
Ovis aries TRGJ2 1 F |
(none)
|
------ACAGCTCGGGC--TGGAAGAAGAT |
Ovis aries TRGJ4 1 P |
(none)
|
------ATGGCTCAGAA--TGAAAGAAGAT |
Ovis aries TRGJ5 1 F |
(none)
|
-----AATCATTGTGACAAGGGATCAAGGT |
Camelus dromedarius TRGJ1 1 F |
(none)
|
------ATAGCTCGGGC--TGGAGGAAGAC |
Ovis aries TRGJ3 1 F |
(none)
|
------ACAGTTCAGGC--TGGAAGAAGAT |
Ovis aries TRGJ6 1 F |
(none)
|
------ACAGCTCAGGT--TGG---AAGAT |
Tursiops truncatus TRGJ1 F |
(none)
|
------ATAGGTCAGGT--TGGATCAAGAT |
Columns
None of the columns has a description.