@ARTICLE{TreeBASE2Ref15468,
author = {Elizabeth A. Friar and Linda M. Prince and Jennifer M. Cruse-Sanders and Mitchell E. McGlaughlin and Charles A. Butterworth and Bruce G. Baldwin},
title = {Hybrid Origin and Genomic Mosaicism of Dubautia scabra (Hawaiian Silversword Alliance; Asteraceae--Madiinae)},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Incongruence among different estimates of species relationships in plants, from different molecules, cytogenetic data, biogeographic data, morphological/anatomical data or other sources, has been used frequently as an indication of introgression, hybrid species origin, or chloroplast (cp) capture. In plants, these incongruences are most often seen between data derived from the nuclear vs. the cp genomes and the nuclear markers used for comparison usually have been from the nuclear ribosomal (nr) internal transcribed spacer region (ITS). The amount of genomic material shared between introgressing species can be highly variable. In some of these cases, other nuclear genomic regions have moved between species without leaving a signature on the nrITS. An example of well-supported phylogenetic incongruence is the placement of Dubautia scabra (DC.) D. D. Keck in the Hawaiian silversword alliance (HSA); evolutionary hypotheses for D. scabra based on molecular as opposed to cytogenetic data are strongly discordant. In this paper, we test these two conflicting phylogenetic hypotheses regarding the evolutionary relationships of Dubautia scabra using evidence from six low-copy nuclear genes, as well as multiple chloroplast noncoding regions and nrITS. The nrITS region is also examined for the presence of multiple copy types. Incongruence between inferred relationships based on nuclear chromosomal arrangements and molecular phylogenetic data from chloroplast DNA and nrITS is resolved in favor of a hypothesis of ancient hybridization rather than cytogenetic homoplasy. Most single-copy nuclear genes track histories of D. scabra compatible with cytogenetic data whereas chloroplast and nrITS data track a common, different history that appears to reflect hybridization with a chromosomally distinct lineage that also occurs on Maui Nui and Hawaii (the Big Island).}
}
Matrix 3006 of Study 1976

Citation title:
"Hybrid Origin and Genomic Mosaicism of Dubautia scabra (Hawaiian Silversword Alliance; Asteraceae--Madiinae)".

This study was previously identified under the legacy study ID S1959
(Status: Published).
Matrices
Title: Dadh-B
Description: Legacy TreeBASE Matrix ID = M3606
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Dubautia waianapanapaensis Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia scabra PH Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia scabra OL Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia scabra HV Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia reticulata Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia platyphylla Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia menziesii Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia linearis Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia laxa hirsuta Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia ciliolata Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Dubautia arborea Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Argyroxiphium sandwicense sandwicense Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Argyroxiphium sandwicense macrocephalum Dadh-B |
(none)
|
AAGTTTTCGACTTTACAAGAATCCGAATTC |
Columns
None of the columns has a description.