@ARTICLE{TreeBASE2Ref15826,
author = {David S. Hibbett and Michael J Donoghue},
title = {Analysis of character correlations among wood decay mechanisms, mating systems, and substrate ranges in homobasidiomycetes.},
year = {2001},
keywords = {Ancestral state reconstruction; basidiomycetes; comparative methods; concentrated changes test; Discrete; fungal ecology; Polyporaceae; rDNA; sensitivity analyses; wood decay},
doi = {10.1080/10635150121079},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {50},
number = {},
pages = {1--27},
abstract = {Homobasidiomycetes include the majority of wood-decaying fungi. Two basic forms of wood decay are known in homobasidiomycetes: white rot, in which lignin and cellulose are degraded, and brown rot, in which lignin is not appreciably degraded. An apparent correlation has been noted between production of a brown rot, decay of conifer substrates, and possession of a bipolar mating system (which has a single mating type locus, vs. tetrapolar systems, which have two mating type loci). The goals of this study were to infer the historical pattern of transformations in decay mode, mating type, and substrate range characters, and to determine if a causal relationship exists among them. We performed a phylogenetic analysis of 130 species of homobasidiomycetes using nuclear and mitochondrial rDNA sequences, and performed ancestral state reconstructions using parsimony on a range of trees, with various loss:gain cost ratios. We evaluated pairwise character correlations using the concentrated changes test (CCT) of Maddison and the maximum likelihood (ML) method of Pagel. White rot, tetrapolar mating systems, and the ability to decay conifers and hardwoods appear to be plesiomorphic in homobasidiomycetes, whereas brown rot, bipolar mating systems, and exclusive decay of conifers appear to have evolved repeatedly. The only significant correlation among characters was that between brown rot (as the independent character) and exclusive decay of conifer substrates. This correlation was supported by the CCT on a range of plausible trees, although not with every reconstruction of ancestral states, and the ML test. Our findings suggest that the evolution of brown rot has promoted repeated shifts to specialization for conifer substrates.}
}
Matrix 3148 of Study 736

Citation title:
"Analysis of character correlations among wood decay mechanisms, mating systems, and substrate ranges in homobasidiomycetes.".

This study was previously identified under the legacy study ID S581
(Status: Published).
Matrices
Title: 18S NJ
Description: Legacy TreeBASE Matrix ID = M3794
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pthirus pubis AY077776 |
(none)
|
------------------------------ |
Pediculus schaeffi AY589943 |
(none)
|
------------------------------ |
Pediculus humanus capitis AF139484 YongRussia |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus capitis AY236410 YongFrance |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139488 YongTunisia |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139481 YongPeru |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139480 YongFrance |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139479 YongRussia |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139478 YongFrance |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AY236416 YongNetherlands |
(none)
|
GTCATATGCTTGTTTCAAAGATTAATCCAT |
Pediculus humanus capitis AY236414 YongPortugal |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AY589942 Leo |
(none)
|
------------------------------ |
Pediculus humanus capitis AY589941 LeoIran |
(none)
|
------------------------------ |
Pediculus humanus capitis AY589940 LeoIran |
(none)
|
------------------------------ |
Pediculus humanus capitis AY589939 LeoNepal |
(none)
|
------------------------------ |
Pediculus humanus humanus AY589938 LeoNepal |
(none)
|
------------------------------ |
Pediculus humanus humanus AF139486 YongBurundi |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AF139482 YongZimbabwe |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus capitis AY236415 YongRwanda |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus capitis AY236413 YongBurundi |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AY236412 YongRwanda |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus humanus AY236411 YongAlgeria |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus capitis AY236418 YongThailand |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Pediculus humanus capitis AY236417 YongChina |
(none)
|
GTCATATGCTTGTTTCAAAGATTAAGCCAT |
Columns
None of the columns has a description.