@ARTICLE{TreeBASE2Ref16384,
author = {Jessica E Light and Melissa A. Toups and David L. Reed},
title = {What's in a name: the taxonomic status of human head and body lice},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Human head lice (Anoplura: Pediculidae: Pediculus) are pandemic, parasitizing countless school children worldwide due to the evolution of insecticide resistance, and human body (clothing) lice are responsible for the deaths of millions as a result of vectoring several deadly bacterial pathogens. Despite the obvious impact these lice have had on their human hosts, it is unclear whether head and body lice represent two morphological forms of a single species or two distinct species. To assess the taxonomic status of head and body lice, we provide a synthesis of publicly available molecular data in Genbank, and we compare phylogenetic and population genetic methods using the most diverse geographic and molecular sampling presently available. Our analyses find reticulated networks, gene flow, and a lack of reciprocal monophyly, all of which indicate that head and body lice do not represent genetically distinct evolutionary units. Based on these findings, as well as inconsistencies of morphological, behavioral, and ecological variability between head and body lice, we contend that no known species concept would recognize these louse morphotypes as separate species. We recommend recognizing head and body lice as morphotypes of a single species, P. humanus, until compelling new data and analyses (preferably analyses of fast evolving nuclear markers in a coalescent framework) indicate otherwise.}
}
Matrix 3149 of Study 2036

Citation title:
"What's in a name: the taxonomic status of human head and body lice".

This study was previously identified under the legacy study ID S2030
(Status: Published).
Matrices
Title: ND4 ML unique haplotypes
Description: Legacy TreeBASE Matrix ID = M3795
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pediculus schaeffi |
(none)
|
ATTATTATATTTACGTGTGTAAGTTTTATT |
Pediculus humanus capitis AY316875 KittlerUK |
(none)
|
ATTGTTGTACTTTTGACTTCTTGTCTTATG |
Pediculus humanus capitis AY316864 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316863 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316872 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316871 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGATTTCTTGTTTTATG |
Pediculus humanus capitis AY316870 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316869 KittlerNepal |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316859 KittlerGermany |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus capitis AY316854 KittlerPNG |
(none)
|
ATTGTTGTGCTTTTGATTTCTTGTTTTATG |
Pediculus humanus capitis AY316851 KittlerTaiwan |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus humanus AY316847 KittlerGermany |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Pediculus humanus humanus AY316840 KittlerEthiopia |
(none)
|
ATTGTTGTGCTTTTGACTTCTTGTTTTATG |
Columns
None of the columns has a description.