CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 3188 of Study 2058

About Citation title: "Multiple hybridization in the Aristolochia kaempferi group (Aristolochiaceae): evidence from reproductive isolation and molecular phylogeny".
About This study was previously identified under the legacy study ID S2057 (Status: Published).

Matrices

Title: PI intron (ML)

Description: Legacy TreeBASE Matrix ID = M3850

Rows

Taxon Label Row Segments Characters 1?–30
Aristolochia saccata Asa homo  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia westlandii SETS36 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia westlandii SETS36 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia moupinensis Mou2 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia kaempferi K158 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai Setu2allele1 AC2allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai K282 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai K282 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai AS2 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai AS2 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia liukiuensis K32 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia liukiuensis K32 allele2  (none) GTATGCCCTTACTTTTTCATAATAAACTGA
Aristolochia cucurbitifolia AC2 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia mollissima AM2 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia moupinensis Mou2 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia manshuriensis SEST21 allele2  (none) GTATGCTCTTTCTTTTTCATAATAAACTGA
Aristolochia manshuriensis SEST21 allele1  (none) GTATGCTCTTTCTTTTTCATAATAAACTGA
Aristolochia kaempferi K642homo K160homo  (none) GTATGCCATTTCTTTTTCATAATAAACTGA
Aristolochia tanzawana K95homo K555homo K653homo  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia K580homo K325homo K61 1 Setu2 2 AM2 1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia kaempferi K61allele2 K437allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia shimadai K437 allele1  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA
Aristolochia kaempferi K158 allele2  (none) GTATGCCCTTTCTTTTTCATAATAAACTGA

Columns

None of the columns has a description.