@ARTICLE{TreeBASE2Ref17562,
author = {Stacey DeWitt Smith and David A. Baum},
title = {Phylogenetics of the florally-diverse Andean clade Iochrominae (Solanaceae)},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {American Journal of Botany},
volume = {},
number = {},
pages = {},
abstract = {Recent molecular phylogenetic studies of Solanaceae have identified many well-supported clades within the family, and have permitted the creation of a phylogenetic system of classification. Here we estimate the phylogeny for Iochrominae, a clade of Physaleae sensu Olmstead et al. (1999), which contains 34 Andean species encompassing an immense diversity of floral forms and colors. Using three nuclear regions, ITS, the second intron of LEAFY and exons 2 to 9 of the granule-bound starch synthase gene (waxy), we evaluate the monophyly of the traditional genera comprising Iochrominae, and we assess the extent of interspecific hybridization within the clade. Our results showed only one of the six traditionally recognized genera of Iochrominae to be monophyletic. Further, comparison of the individual nuclear datasets revealed two interspecific hybrid taxa and a third possible case. We note that these hybrid taxa occur in the Amotape-Huancabamba zone, a region between the Northern and Central Andes that has the greatest diversity of Iochroma species and offers frequent opportunities for hybridization in areas of sympatry. We postulate that periodic hybridization events, such as those documented in our study, coupled with pollinator-mediated selection and the potential for microallopatry in montane Andean habitats may have promoted the diversification of floral form and color observed in Iochrominae.}
}
Matrix 45253 of Study 1553

Citation title:
"Phylogenetics of the florally-diverse Andean clade Iochrominae (Solanaceae)".

This study was previously identified under the legacy study ID S1498
(Status: Published).
Matrices
Title: Cystotheca ITS 13 taxa
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cystotheca lanestris Ex_Quercus_MUMH6845_MEX |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca lanestris Ex_Quercus_AB000933_USA |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca wrightii Ex_Quercus_KF735066_KOR |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca lanestris Ex_Quercus_AF073354_KOR |
(none)
|
CTGAGCGTGAAGCCACGCTGGGCGCCTGGC |
Cystotheca wrightii Ex_Quercus_AB000932_JPN |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca lanestris Ex_Quercus_AF011289_USA |
(none)
|
------------GCACGCTGGGCGCCTGGC |
Cystotheca lanestris Ex_Myrica_AF011288_USA |
(none)
|
---------------CGCTGGGCGCCTGGC |
Cystotheca tjibodensis Ex_Castanopsis_JN807326_IDN |
(none)
|
---GACGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca lanestris Ex_Castanea_KR048055_CHN |
(none)
|
CTGAGCGTGAAGCCACGCTGGGCGCCTGGC |
Cystotheca tjibodensis Ex_Castanopsis_JN807325_IDN |
(none)
|
------------------------------ |
Setoidium castanopsidis Ex_Castanopsis_AB743782_IDN |
(none)
|
----------------------CGCCTGGC |
Setoidium castanopsidis Ex_Castanopsis_AB743781_IDN |
(none)
|
----------------------CGCCTGGC |
Sawadaea nankinensis Ex_Acer_AB353763 |
(none)
|
CTGAGCGTGAGGCCACGCAGGGCGC---AA |
Columns
None of the columns has a description.