@ARTICLE{TreeBASE2Ref26999,
author = {Shawn Christopher Kenaley},
title = {First report of Puccinia coronata var. coronata s.s. infecting alder buckthorn in the United States},
year = {2017},
keywords = {Crown rust; Fragula alnus; Pucciniales},
doi = {},
url = {http://},
pmid = {},
journal = {Plant Health Progress},
volume = {},
number = {},
pages = {},
abstract = {The raw DNA sequences produced from the suspected Puccinia sp. on alder buckthorn collected in Storrs, Connecticut were edited in CodonCode Aligner v5.1.5 (CodonCode Corporation,Dedham, MA) to address ambiguous base calls. Alignments were constructed using Clustal X v2.1 (Larkin et al. 2007) and adjusted by eye in Geneious v.9.0.5 (Biomatters Ltd., Auckland, New Zealand) to correct ambiguously aligned sites and erroneous gaps.
Phylogenetic analyses integrated two approaches: maximum-likelihood (ML) and maximum parsimony (MP). ML and MP analyses were performed using PAUP* (Swofford 2003). For the ML analyses, the best model of sequence evolution for each alignment (gene region) was selected by the Akaike Information Criterion (AIC; Akaike 1974) implemented in jModelTest 2.1.10 (Darriba et al. 2012). A heuristic search was performed with 1000 random-addition-sequence (RAS) replicates, tree bisection-reconnection (TBR) branch swapping, and MULTREES in effect. All nucleotides were included in the phylogenetic analysis. Branch support was evaluated using 1000 bootstrap replicates and 100 RAS per pseudo-replicate. MP analysis was conducted with the heuristic search option with 1000 RAS replicates and TBR as the branch-swapping algorithm. The robustness of the most parsimonious trees was evaluated by 1000 bootstrap replicates.}
}
Matrix 40449 of Study 20727

Citation title:
"First report of Puccinia coronata var. coronata s.s. infecting alder buckthorn in the United States".

Study name:
"First report of Puccinia coronata var. coronata s.s. infecting alder buckthorn in the United States".

This study is part of submission 20727
(Status: Published).
Matrices
Title: Puccinia RPB2 ML
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Puccinia graminis HQ317657 |
(none)
|
AGACGTGTCGATGCCGCTGAAGTCGACGGA |
Puccinia graminis HQ317641 |
(none)
|
AGACGTGTCGATGCCGCTGAAGTCGACGGA |
Puccinia coronata var. avenae f.sp. graminicola HM147376 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronata var. avenae f.sp. graminicola HM147373 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronata var. avenae f.sp. avenae HM147344 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronata var. avenae f.sp. avenae HM147354 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia sp. Alder buckthorn CT |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronata var coronata HM147367 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronati-brevispora HM147359 |
(none)
|
------------------------------ |
Puccinia coronati-brevispora HM147377 |
(none)
|
------------------------------ |
Puccinia coronati-calamagrostidis HM147347 |
(none)
|
------------------------------ |
Puccinia coronati-calamagrostidis HM147375 |
(none)
|
GGACGTCTCGATGCCTTTGAAATCAACGGA |
Puccinia coronati-hordei HM147346 |
(none)
|
------------------------------ |
Puccinia coronati-agrostidis HM147345 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronati-agrostidis HM147379 |
(none)
|
GGACGTGTCGATGCCCTTGAAGTCGACGGA |
Puccinia coronati-japonica HM147378 |
(none)
|
------------------------------ |
Columns
None of the columns has a description.