@INCOLLECTION{TreeBASE2Ref22468,
author = {Christian H. Uhink and Joachim W. Kadereit},
title = {Phylogeny and Biogeography of the Hyoscyameae (Solanaceae): European - East Asian Disjunctions and the Origin of European Mountain Plant Taxa.},
year = {2009},
keywords = {ITS, ndhF/trnLF, BEAST, Bayesian relaxed molecular clock.},
doi = {},
url = {http://ubm.opus.hbz-nrw.de/volltexte/2009/2046/pdf/diss.pdf},
pmid = {},
booktitle = {Uhink C.H., eds. Biogeographische Beziehungen zwischen den Alpen, dem Kaukasus und den asiatischen Hochgebirgen.},
isbn = {},
publisher = {Johannes Gutenberg-Universit?t Mainz},
address = {Mainz},
editor = {Christian Helmut Uhink},
pages = {22--54},
abstract = {It has long been claimed that Asian high mountain areas constitute an important source for European mountain floras. The connection between these areas might have been through intervening mountain regions such as the Himalayas, Hindu Kush, Elburs and Caucasus, or along a more northern route. To address this question, we have analysed plant groups with a disjunct distribution in Eurasia (Europe, Caucasus and East Asia). Their phylogeny is expected to reveal the sequence of range splits in Eurasia, and to answer the question whether the European representatives are closely related to taxa in the Caucasus than to eastern representatives or not. If yes, this is interpreted as evidence in favour of a mountain route from Asia into Europe. The Hyoscyameae, a tribe of Solanaceae, consisting of Atropa, Scopolia, Hyoscyamus, Physochlaina, Atropanthe, Anisodus and Prezewalskia is a well-supported monophyletic clade. Whereas the latter three genera have a rather narrow distribution area and are endemic to W China and the Himalayas, the remaining genera are widely or disjunctly distributed in Asia and reach into Europe and even N Africa. Several taxa of Hyoscyameae have a montane or alpine ecology and are associated with mountain ranges. We reconstructed the phylogeny of the Hyoscyameae using nuclear and plastid markers. All genera were found to be monophyletic, but relationships among them are not fully supported. In the Prezewalskia/Physochlaina/Scopolia clade first branches are mainly found 21
in W China and C Asia and the close relationship between European/Caucasian and Japanese Scopolia taxa supports the assumption of a northern connection between the European mountains and E Asia. This is congruent with results obtained by us in Epimedium (Berberidaceae). In Atropa, A. baetica from N Africa/Southwest Europe is sister to the remainder of the genus which is distributed across Europe, in the Caucasus and in C Asia. The Himalayan A. acuminatum can not be distinguished from the European A. belladonna on the DNA-sequence level, and both are part of a polytomy together with Caucasian and C Asian taxa. Although these latter results do not allow us to draw any conclusions about the relationships and possible origin of most of the European material of Atropa, the sister group relationship of A. baetica to the rest of the genus may imply that much in contrast to our findings in the Prezewalskia/Physochlaina/Scopolia-clade, range formation in Atropa proceeded from west to east.}
}
Matrix 3283 of Study 10940

Citation title:
"Phylogeny and Biogeography of the Hyoscyameae (Solanaceae): European - East Asian Disjunctions and the Origin of European Mountain Plant Taxa.".

Study name:
"Phylogeny and Biogeography of the Hyoscyameae (Solanaceae): European - East Asian Disjunctions and the Origin of European Mountain Plant Taxa.".

This study is part of submission 10930
(Status: Published).
Matrices
Title: 16S Flotidae
Description: Legacy TreeBASE Matrix ID = M3951
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pherusa plumosa California |
(none)
|
?????????????????????????????? |
Pherusa plumosa Massachusetts |
(none)
|
?????????????????????????????? |
Poeobius meseres |
(none)
|
------------------------------ |
Therochaeta collarifera |
(none)
|
?????????????????????????????? |
Brada villosa California |
(none)
|
?????????????????????????????? |
Brada villosa Sweden |
(none)
|
?????????????????????????????? |
Diplocirrus glaucus Sweden |
(none)
|
?????????????????????????????? |
Flabelliderma ockeri |
(none)
|
------------------------------ |
Flabelligena sp. |
(none)
|
AAACATTGCCTTATGAATAA-ATTATATAA |
Flabelligera affinis California |
(none)
|
?????????????????????????????? |
Flabelligera affinis Iceland |
(none)
|
------------------------------ |
Flabelligera affinis Sweden |
(none)
|
?????????????????????????????? |
Flabelligera infundibularis |
(none)
|
------------------------------ |
Flota sp. specimen 1 |
(none)
|
AAACATTGTCTCTTGCAATATAAATAATAA |
Flota sp. specimen 2 |
(none)
|
?????????????????????????????? |
Ilyphagus octobranchus |
(none)
|
?????????????????????????????? |
Macrochaeta clavicornis |
(none)
|
?????????????????????????????? |
Macrochaeta sp. |
(none)
|
------------------------------ |
Columns
None of the columns has a description.