@ARTICLE{TreeBASE2Ref27363,
author = {Kebede Tadesse Muleta and Matthew N Rouse and Shery Rynearson and Xianming Chen and Bedada G Buta and Michael Pumphrey},
title = {Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions},
year = {2017},
keywords = {Bread wheat, stripe rust, stem rust, genetic resistance, genetic diversity, association mapping},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Plant Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations.
Results: Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons; and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust at all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) <0.10. GWAS also detected 9 additional genomic regions significantly associated (FDR-adjusted P <0.10) with seedling resistance to stem rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel.
Conclusion: Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in this study should be useful in efficiently targeting the associated resistance loci in marker-assisted breeding for rust resistance in Ethiopia and other countries.
}
}
Matrix 58021 of Study 21219
Citation title:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".
Study name:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".
This study is part of submission 21219
(Status: Published).
Matrices
Title: Lembosiniella - ITS alignment
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Elsinoe flacourtiae NR_148141_CBS_474.62 |
(none)
|
ACGAGGTAGGGC--CTCCCCCGGGAGCCCG |
| Elsinoe pitangae NR_148162_CBS_227.50 |
(none)
|
ACGAGGTAGGGC--CTCCTCCGGGAGCCCG |
| Elsinoe perseae NR_148160_CBS_406.34 |
(none)
|
ACGAGGTAGGGC--CTCCTCCGGGAGCCCG |
| Elsinoe hederae NR_148146_CBS_517.50 |
(none)
|
ACGAGGTAGGGC--CTCCTTCGGGAGCCCG |
| Elsinoe arachidis NR_148125_CBS_511.50 |
(none)
|
ACGAGGTAGGGTTCTCCCTCGGGAAGCCCG |
| Elsinoe barleriicola NR_148128_CBS_471.62 |
(none)
|
ACGAGGTAGGGTTCTCCTCCGGGAAGCCCG |
| Elsinoe proteae NR_132796_STE_U_1349 |
(none)
|
ACGAGGTAGGGC--CTCCTTCGGGAGCCCG |
| Elsinoe eucalyptorum NR_155080_CBS_120084 |
(none)
|
AAGAGTAAGGGT--TCCCGAAAGGGGCCCG |
| Elsinoe oleae NR_148159_CBS_227.59 |
(none)
|
ACGAGGAAGGGT--TCCCGAAAGGGGCCCG |
| Elsinoe rosarum NR_148167_CBS_212.33 |
(none)
|
ACGAGGAAGGGT--TTCCGAAAGGAGCCCG |
| Elsinoe jasminicola NR_148149_CBS_212.63 |
(none)
|
ACGAGGTAGGGC--CTCCCCCGGGAGCCCG |
| Elsinoe quercus ilicis_NR_148164_CBS_232.61 |
(none)
|
CCGAGGAAGGGT--TCCCGCGAGGGGCCCG |
| Elsinoe eucalyptigena NR_155099_CPC_29529 |
(none)
|
AAGAGTATGGGT--CATCC---GTGGCCCG |
| Elsinoe banksiigena NR_159837_CPC_32402 |
(none)
|
AAGAGCAAGGGT--CCCCC---GGGGCCCG |
| Myriangium citri KU720543_MAsS1 |
(none)
|
---------GGT--ACTTT---TGTGCCCG |
| Myriangium haraeanum MH855532_CBS_300.34 |
(none)
|
AAGAGTTAGGGT--CCTTC---GGGGCCCA |
| Myriangium duriaei MH855793_CBS_260.36 |
(none)
|
AAGAGTTGGGGT--CCTCC---GGGGCCCG |
| Lembosiniella eucalyptorum NR_165601_CBS_144603 |
(none)
|
CAGAGTTAGGGT--CTTC----CAGGCCCG |
| Lembosiniella sp. CSN1210 ITS4 |
(none)
|
------------------------------ |
| Lembosiniella sp. CSN1225 ITS5 CS31 |
(none)
|
------------------------------ |
| Delphinella strobiligena MH860318_CBS_735.71 |
(none)
|
AAGAGATAGGGT--CTTC----ATGGCCCG |
| Stylodothis puccinioides MH857753_CBS_193.58 |
(none)
|
GGGAAACCGGTG--TTCC----TCGA--CT |
| Cladosporium cladosporioides MH857281_CBS_170.54 |
(none)
|
-----CAAGTGA--CCCCGGCTACGGCCGG |
| Capnodium salicinum MH855469_CBS_131.34 |
(none)
|
ATGAGTGATGGG--------CTTCGGCCCG |
| Diplodia tsugae MH870106_CBS_418.64 |
(none)
|
CCGAGTT-------CTCGGGCTTCGGCCCG |
| Patellaria quercus NR_152540_CPC_27232 |
(none)
|
ATAGAG----------------TATGCACG |
Columns
None of the columns has a description.
Go to search
Citation
Taxa
Matrices
Trees
Analyses
