@ARTICLE{TreeBASE2Ref27363,
author = {Kebede Tadesse Muleta and Matthew N Rouse and Shery Rynearson and Xianming Chen and Bedada G Buta and Michael Pumphrey},
title = {Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions},
year = {2017},
keywords = {Bread wheat, stripe rust, stem rust, genetic resistance, genetic diversity, association mapping},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Plant Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations.
Results: Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons; and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust at all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) <0.10. GWAS also detected 9 additional genomic regions significantly associated (FDR-adjusted P <0.10) with seedling resistance to stem rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel.
Conclusion: Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in this study should be useful in efficiently targeting the associated resistance loci in marker-assisted breeding for rust resistance in Ethiopia and other countries.
}
}
Matrix 58023 of Study 21219

Citation title:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

Study name:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

This study is part of submission 21219
(Status: Published).
Matrices
Title: Hysterium - ITS alignment
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Hysterium pulicare ECSN1227_ITS4 |
(none)
|
GTTGAAGAAGC------------GAATGGT |
Hysterium pulicare EU552137_CMW_20409 |
(none)
|
GTTGAAGAAGCG-----------GAATGGT |
Hysterium angustatum MN608547_MFLUCC_11_0004 |
(none)
|
------------------------------ |
Hysterium pulicare MH855497_CBS_240.34 |
(none)
|
------------------------------ |
Hysterium angustatum KX611363_MFLU_16_1179 |
(none)
|
------------------------------ |
Hysterium rhizophorae MG844284_PUFD43 |
(none)
|
------------------------------ |
Hysterium sp. CSN1108 ITS5 |
(none)
|
ACAGACAGTGGGATGTTATGTACGAGCTAT |
Psiloglonium colihuae KP744466_MFLUCC_11_0178 |
(none)
|
------------------------------ |
Psiloglonium sasicola KP744467_MFLUCC_10_0565 |
(none)
|
T----------------------------- |
Hysterium thailandica MH535873_MFLUCC_16_0338 |
(none)
|
------------------------------ |
Hysterium doimaeensis MH535872_MFLUCC_16_0329 |
(none)
|
------------------------------ |
Columns
None of the columns has a description.