@ARTICLE{TreeBASE2Ref27363,
author = {Kebede Tadesse Muleta and Matthew N Rouse and Shery Rynearson and Xianming Chen and Bedada G Buta and Michael Pumphrey},
title = {Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions},
year = {2017},
keywords = {Bread wheat, stripe rust, stem rust, genetic resistance, genetic diversity, association mapping},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Plant Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations.
Results: Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons; and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust at all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) <0.10. GWAS also detected 9 additional genomic regions significantly associated (FDR-adjusted P <0.10) with seedling resistance to stem rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel.
Conclusion: Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in this study should be useful in efficiently targeting the associated resistance loci in marker-assisted breeding for rust resistance in Ethiopia and other countries.
}
}
Matrix 58047 of Study 21219

Citation title:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

Study name:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

This study is part of submission 21219
(Status: Published).
Matrices
Title: Nigrograna - ITS alignment
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Nigrograna mackinnonii NR_132037_CBS_674.75 |
(none)
|
CCGTTGGAGTTC----GCTCCAATCTGGGA |
Nigrograna fuscidula NR_147653_MF7 |
(none)
|
CCGTTGGAGTCC----GCTCCAATCTGGGA |
Nigrograna chromolaenae MT214379_MFLUCC_17_1437 |
(none)
|
----------------GCTCCAATCTGGGA |
Nigrograna antibiotica NR_158296_CCF_4378 |
(none)
|
CCGTTGGAGCTCT---GCTCCAATCTGGGA |
Nigrograna carollii LN626657_CCF4484 |
(none)
|
CAGTTGGAGCCC----GCTCCAATCTGGGA |
Nigrograna yasuniana HQ108005_E8604b |
(none)
|
CCGTTGGAGCTC----GCTCC-ATCTGGGA |
Nigrograna sp. ITS4 CS022 CSN591 |
(none)
|
CCGTTGGAGCTC----GCTCC-ATCTGGGA |
Nigrograna norvegica NR_147655_TR8 |
(none)
|
CCGTTGGAGCTCT---GCTCCAATCCGGGA |
Nigrograna obliqua NR_147656_MF2 |
(none)
|
CCGTTGGAGTTC----GCTCC-ATCTGGGA |
Nigrograna mycophila NR_147654_MF5 |
(none)
|
CCGTTGGAGTTC----GCTCC-ATCTGGGA |
Nigrograna cangshanensis NR_155486_MFLUCC_15_0253 |
(none)
|
CCGTTGGGGCTT----GCTCC-ATCCGGGA |
Nigrograna thymi NR_160462_MFLU_17_0497 |
(none)
|
CCGTTGGAGCTT----GCTCC-ATCTGGGA |
Nigrograna thymi MN075272_MFLUCC_19_0039 |
(none)
|
CCGTTGGAGCTT----GCTCC-ATCTGGGA |
Nigrograna peruviensis LN626658_CCF4485 |
(none)
|
CCGTTGGGGGTCA--AACTCC-AATCGGGA |
Nigrograna rhizophorae MN047085_MFLU_19_1233 |
(none)
|
CCGTTGGAGCTC----GCTCCAATCTGGGA |
Neooccultibambusa chiangraiensis NR_154238_MFLUCC_12_0559 |
(none)
|
TCGAAGGGGATT----TCTCC-CCTCGAGA |
Occultibambusa fusispora NR_154340_MFLUCC_11_0127 |
(none)
|
CAGTAGGGGGGCTCGCCCCCCCCCGCAAGA |
Columns
None of the columns has a description.