@ARTICLE{TreeBASE2Ref27363,
author = {Kebede Tadesse Muleta and Matthew N Rouse and Shery Rynearson and Xianming Chen and Bedada G Buta and Michael Pumphrey},
title = {Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions},
year = {2017},
keywords = {Bread wheat, stripe rust, stem rust, genetic resistance, genetic diversity, association mapping},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Plant Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations.
Results: Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons; and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust at all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) <0.10. GWAS also detected 9 additional genomic regions significantly associated (FDR-adjusted P <0.10) with seedling resistance to stem rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel.
Conclusion: Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in this study should be useful in efficiently targeting the associated resistance loci in marker-assisted breeding for rust resistance in Ethiopia and other countries.
}
}
Matrix 58067 of Study 21219

Citation title:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

Study name:
"Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions".

This study is part of submission 21219
(Status: Published).
Matrices
Title: Pseudocamarosporium - ITS alignment
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Pseudocamarosporium africanum NR_154294_CBS_121166 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium eucalypti NR_166345_CPC_37995 |
(none)
|
TCTATTTTAATGGTGTTGGTTGCGGCCCCC |
Pseudocamarosporium corni NR_154308_MFLUCC_13_0541 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium propinquum NR_154309_MFLUCC_13_0544 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium tilicola KJ747050_MFLUCC_13_0550 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium sp. CSN1104 ITS5 CS29 |
(none)
|
------------------------------ |
Pseudocamarosporium pteleae NR_157536_MFLUCC_17_0724 |
(none)
|
------------------------------ |
Pseudocamarosporium pinicola KT222273_MFLUCC140457 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium lonicerae NR_154307_MFLUCC_13_0532 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium cotinae KP744460_MFLUCC_14_0624 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium pini KU764779_MFLUCC_14_1091 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Pseudocamarosporium ulmi minoris_NR_157537_MFLUCC_17_0671 |
(none)
|
------------------------------ |
Pseudocamarosporium brabeji MH374405_F232 |
(none)
|
------------------------------ |
Pseudocamarosporium piceae NR_154306_MFLUCC_14_0192 |
(none)
|
TCTATTTTAATGGTGTTGGTCGCGGCCCCC |
Paracamarosporium hawaiiense NR_154287_CPC_12265 |
(none)
|
TCTATTTTAACGGTGTTGGTTGCGGCCTCC |
Paracamarosporium fagi NR_154318_CPC_24890 |
(none)
|
TCTATTTTAACGGTGTTGGTTGCGGCCTCC |
Paracamarosporium tamaricis NR_165847_MFLUCC_15_0494 |
(none)
|
TCTATTTTAACGGTGTTGGTTGCGGCCTCC |
Paracamarosporium mamanes NR_154288_CPC_12252 |
(none)
|
TCTATTTTAACGGTGTTGGTTGCGGCCCCT |
Paracamarosporium psoraleae NR_154300_CPC_21632 |
(none)
|
TCTATTTTAACGGTGTTGGTTGCGGCCCCT |
Columns
None of the columns has a description.