@ARTICLE{TreeBASE2Ref27796,
author = {Pier Cacciali and Gunther Koehler},
title = {Diversity of Tropidurus (Squamata: Tropiduridae) in Paraguay ? an integrative taxonomic approach based on morphological and molecular genetic evidence},
year = {2018},
keywords = {Iguanoidea, 16S, COI, PRLR, South America, ring species},
doi = {10.11646/zootaxa.4375.4.3},
url = {http://http://www.mapress.com/j/zt/article/view/zootaxa.4375.4.3},
pmid = {},
journal = {Zootaxa},
volume = {4375},
number = {4},
pages = {511--536},
abstract = {Tropidurus is a Neotropical genus of iguanoid lizards characterized by a conspicuously enlarged interparietal plate, the presence of gular folds, presence of infradigital keels, and the absence of femoral pores. Currently, 29 species are recognized within the genus, seven of which are present in Paraguay: T. etheridgei, T. torquatus, T. guarani, T. lagunablanca, T. spinulosus, T. tarara, and T. teyumirim. We generated genetic data based on two DNA mitochondrial markers (16S and COI) and one nuclear (PRLR) marker for all the seven Paraguayan species with the goal to identify the taxonomic relationships among taxa based on the intra- and interspecific genetic variation and the construction of molecular clusters. ML and BI analyses match in the recognition of two main clusters: groups torquatus and spinulosus, and within the torquatus group the differentiation between T. catalanensis and T. etheridgei is highly supported. Nevertheless, there is a complete lack of congruence between mitochondrial and nuclear genes in the topology within the spinulosus group. Tropidurus guarani and T. spinulosus are more differentiated from the remaining species of the spinulosus group with genetic p-distances from 4.0 to 6.0. Low distances were found between T. lagunablanca and T. tarara (1.0?1.1%), and slightly higher, among T. teyumirim, T. lagunablanca, and T. tarara (2.0?2.6% respectively). From a morphological perspective, species of the Tropidurus torquatus group are easily distinguished; but we found strong overlaps of scalation characters in the guarani group. We interpret the low genetic distances documented among the nominal taxa Tropidurus lagunablanca, T. tarara, and T. teyumirim as evidence for conspecificity. This hypothesis is supported by the lack of morphological characters that would diagnose any of the three taxa. Similarly, we found low genetic distances among populations assigned to the nominal taxa T. guarani and T. spinulosus, including samples from near the type locality of the former, and then we recognize only two species of the T. spinulosus complex in Paraguay: T. spinulosus and T. lagunablanca.}
}
Matrix 44490 of Study 21797

Citation title:
"Diversity of Tropidurus (Squamata: Tropiduridae) in Paraguay ? an integrative taxonomic approach based on morphological and molecular genetic evidence".

Study name:
"Diversity of Tropidurus (Squamata: Tropiduridae) in Paraguay ? an integrative taxonomic approach based on morphological and molecular genetic evidence".

This study is part of submission 21797
(Status: Published).
Matrices
Title: Tropidurus 16S Matrix
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Plica plica AMCC106953 |
(none)
|
?????????????????????????????? |
| Tropidurus catalanensis SMF100093 |
(none)
|
AAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus catalanensis SMF100090 |
(none)
|
??????????GGT-ACGCCTG-CCAGTG-A |
| Tropidurus catalanensis UFRGST2890 |
(none)
|
?????????????????????????????? |
| Tropidurus etheridgei SMF101595 |
(none)
|
AAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus etheridgei SMF101596 |
(none)
|
AAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus etheridgei LG1096 |
(none)
|
AAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus guarani SMF100095 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus guarani SMF100096 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAA |
| Tropidurus lagunablanca SMF103320 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus spinulosus AMCC204478 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus spinulosus SMF100094 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus spinulosus IIBPH3463 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus tarara SMF103314 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus tarara SMF103315 |
(none)
|
?????????????????????????????? |
| Tropidurus tarara SMF103316 |
(none)
|
TAGTATTAAAGGTAACGCCTGCCCAGTGAG |
| Tropidurus teyumirim AMNHFS20281 |
(none)
|
?????????AAGTAACGCCTGCCCAGTGAG |
Columns
None of the columns has a description.