@ARTICLE{TreeBASE2Ref2121,
author = {P. Stephen Corn and Anna M. Goebel and Richard G. Olmstead and Tom A. Ranker},
title = {Mitochondrial DNA Evolution in the Anaxyrus boreas Species Group.},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {The Anaxyrus boreas species group currently comprises four species in western North America including the broadly distributed Anaxyrus boreas, and three localized species, A. nelsoni, A. exsul and A. canorus. Phylogenetic analyses of the mtDNA 12S rDNA, cytochrome oxidase I, control region, and restriction sites data, identified three major haplotype clades. The Northwest clade (NW) includes both subspecies of A. boreas and divergent minor clades in the middle Rocky Mountains, coastal, and central regions of the west and Pacific Northwest. The Southwest (SW) clade includes A. exsul, A. nelsoni, and minor clades in southern California. Anaxyrus canorus, previously identified as paraphyletic, has populations in both the NW and SW major clades. The Eastern major clade (E) includes three divergent lineages from southern Utah, the southern Rocky Mountains, and north of the Great Basin at the border of Utah and Nevada. These results identify new genetic variation in the eastern portion of the toads range and are consistent with previous regional studies from the west coast. Low levels of control region sequence divergence between major clades (2.2-4.7 % uncorrected pair-wise distances) are consistent with Pleistocene divergence and suggest that the phylogeographic history of the group was heavily influenced by dynamic Pleistocene glacial and climatic changes, and especially pluvial changes, in western North America. Results reported here may impact conservation plans in that the current taxonomy does not reflect the diversity in the group.}
}
Matrix 3590 of Study 2184

Citation title:
"Mitochondrial DNA Evolution in the Anaxyrus boreas Species Group.".

This study was previously identified under the legacy study ID S2194
(Status: Published).
Matrices
Title: Anaxyrus boreas - 12S rDNA
Description: Legacy TreeBASE Matrix ID = M4157
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Anaxyrus exsul 327InCA |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus nelsoni 168NyNV |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas halophilus 014InCA |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas halophilus 603SDCA |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 297KaUT |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 332SuUT |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 138LaCO |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 233GuCO |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 400BEUT |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 246DeOR |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 248DeOR |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus canorus 329MoCA |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 112TCWA |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 109TeWY |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Anaxyrus boreas boreas 355VCCn |
(none)
|
CAAAGGTTTGGTCCTGGCCTTGAGGTCAGT |
Columns
None of the columns has a description.