@ARTICLE{TreeBASE2Ref2122,
author = {Marjorie A. Hoy and Ayyamperumal Jeyaprakash},
title = {First divergence time estimate of spiders, scorpions, mites and ticks (Subphylum: Chelicerata) inferred from mitochondrial phylogeny.},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Experimental and Applied Acarology},
volume = {},
number = {},
pages = {},
abstract = {Spiders, scorpions, mites and ticks (chelicerates) form one of the most diverse groups of arthropods on land, but their origin and times of diversification are not yet established. We estimated, for the first time, the molecular divergence times for these chelicerates using complete mitochondrial sequences from 25 taxa. All mitochondrial genes were evaluated individually or after concatenation. Sequences belonging to three missing genes (ND3, 6 and tRNA-Asp) from three taxa, as well as the faster-evolving ribosomal RNAs (12S and 16S), tRNAs, and the third base of each codon from 11 protein-coding genes (PCGs) (COI-III, CYTB, ATP8, 6, ND1-2, 4L and 4-5), were identified and removed. The remaining concatenated sequences from 11 PCGs produced a completely resolved phylogenetic tree and confirmed that all chelicerates are monophyletic. Removing the third base from each codon was essential to resolve the phylogeny, which allowed deep divergence times to be calculated using three nodes calibrated with upper and lower priors. Our estimates indicate that the orders and classes of spiders, scorpions, mites and ticks diversified in the late Paleozoic, much earlier than previously reported from fossil date estimates. The divergence time estimated for ticks suggests that their first land hosts could have been amphibians rather than reptiles. Using molecular data, we separated the spider-scorpion clades and estimated their divergence times at 397 ? 23 million years ago. Algae, fungi, plants and animals, including insects, were well established on land when these chelicerates diversified. Future analyses, involving mitochondrial sequences from additional chelicerate taxa and the inclusion of nuclear genes (or entire genomes) will provide a more complete picture of the evolution of the Chelicerata, the second most abundant group of animals on earth.}
}
Matrix 3860 of Study 2185

Citation title:
"First divergence time estimate of spiders, scorpions, mites and ticks (Subphylum: Chelicerata) inferred from mitochondrial phylogeny.".

This study was previously identified under the legacy study ID S2192
(Status: Published).
Matrices
Title: Chelicerate mtDNAs Table 1
Description: Legacy TreeBASE Matrix ID = M4152
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Nephila clavata |
(none)
|
------TTACTGCGATGATTATATTCAACA |
| Ornithoctonus huwena |
(none)
|
------TTACTGCGATGGTTGTTTTCTACA |
| Mesobuthus gibbosus |
(none)
|
---------ATGCGATGGTTATATTCAACA |
| Mesobuthus martensii |
(none)
|
---------TTGCGATGATTATATTCTACG |
| Centruroides limpidus |
(none)
|
---------TTGCGATGATTGTATTCTACG |
| Priapulus caudatus |
(none)
|
---ATTCTACCGCGATGATTTTTTTCAACT |
| Artemia franciscana |
(none)
|
------ATGCAACGTTGATTTTATTCTACG |
| Daphnia pulex |
(none)
|
---TTATTGCGACGTTGACTCTTCTCAACT |
| Drosophila melanogaster |
(none)
|
------TCGCGACAATGATTATTTTCTACA |
| Locusta migratoria |
(none)
|
------ACGCAAAAATGATTATTCTCAACA |
| Narceus annularus |
(none)
|
---------ACGCGATGACTCTTCTCCACT |
| Thyropygus sp. |
(none)
|
---------ACGCGATGATTATTTTCCACA |
| Lithobius forficatus |
(none)
|
------ATACTGCGATGAATATTTTCTACA |
| Bothroplys sp. |
(none)
|
------CTTCTGCGATGAATATTTTCCACC |
| Scutigera coleoptrata |
(none)
|
------TATGACCGATGATTTTTTTCTACT |
| Scutigerella causeyae |
(none)
|
---ATTTTACTGCGATGACTTTTTTCTACT |
| Limulus polyphemus |
(none)
|
------TTACCGCGATGACTTTATTCAACA |
| Nymphon gracile |
(none)
|
------ATAGAACGTTGATTTAGATCTACT |
| Achelia bituberculata |
(none)
|
------GAATTCACTAGTGATTGGTCAACA |
| Carios capensis |
(none)
|
---ATTTTACCGCGATGAATATTTTCAACA |
| Ornithodoros moubata |
(none)
|
---ATTTTACCGCGATGATTTTATTCAACA |
| Ornithodoros porcinus |
(none)
|
---ATTTTACCGCGATGATTTTATTCTACA |
| Ixodes hexagonus |
(none)
|
---ATTTTACCGCGATGATTATTCTCTACA |
| Ixodes persulcatus |
(none)
|
---ATTTTACCGCGATGACTTTTCTCCACA |
| Ixodes holocyclus |
(none)
|
---ATTTTACCGCGATGACTTTTTTCCACA |
| Ixodes uriae |
(none)
|
---ATTTTACCGCGATGATTTTACTCTACA |
| Rhipicephalus sanguineus |
(none)
|
---ATTTTACCGCGATGAATATACTCTACT |
| Amblyomma triguttatum |
(none)
|
------------------ATATTCTCCACT |
| Haemaphysalis flava |
(none)
|
---ATTTTACCGCGATGAATATTTTCCACT |
| Metaseiulus occidentalis |
(none)
|
---ATAATAAACAAATGAATTTCATCTACT |
| Varroa destructor |
(none)
|
ATAAGATTAATACGTTGATTATTTTCTTGT |
| Leptotrombidium akamushi |
(none)
|
---ATGTTAAATCGATGAGCTTTTTCAACA |
| Leptotrombidium deliense |
(none)
|
---ATGATAAATCGATGGGCATTTTCCACT |
| Leptotrombidium pallidum |
(none)
|
---ATGATAAATCGATGAGCTTTTTCTACA |
| Heptathela hangzhouensis |
(none)
|
---------TTGCGATGATTATTTTCAACA |
| Habronattus oregonensis |
(none)
|
ATTGAGTTACTGCGATGATTATATTCTACT |
Columns
None of the columns has a description.