@ARTICLE{TreeBASE2Ref2129,
author = {Katriina L Ilves and Eric B Taylor},
title = {Molecular resolution of the systematics of a problematic group of fishes (Teleostei: Osmeridae) and evidence for morphological homoplasy.},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Relationships among the species of Northern Hemisphere smelts (family Osmeridae) have long been debated in the fish systematics literature. Eight independent studies based on morphological characters failed to reach any consensus on osmerid interrelationships. We reconstruct the osmerid phylogeny based on DNA sequence data from three mitochondrial (cytb, 16S, 12S) and three nuclear (ITS2, S71, RAG1) gene regions from multiple individuals of the 14 species in 6 genera, using the Japanese ayu (Plecoglossus altivelis) as the outgroup. Analyses with different combinations of nuclear and mitochondrial datasets yielded a generally well-resolved phylogeny of the genera that conflicts with previous hypotheses of osmerid interrelationships, and Shimodaira-Hasegawa tests suggest our topology with the current molecular dataset is significantly better than earlier reconstructions. In addition, mapping 114 morphological characters used in previous studies onto our phylogeny shows widespread homoplasy, which is likely the source of the systematic disagreement produced in earlier works.}
}
Matrix 3361 of Study 2192

Citation title:
"Molecular resolution of the systematics of a problematic group of fishes (Teleostei: Osmeridae) and evidence for morphological homoplasy.".

This study was previously identified under the legacy study ID S2200
(Status: Published).
Matrices
Title: nDNA Concatenated
Description: Legacy TreeBASE Matrix ID = M4172
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Allosmerus elongatus |
(none)
|
GCTTTGCCATCAATCGGAAA---------- |
Hypomesus nipponensis |
(none)
|
------------------------------ |
Hypomesus japonicus |
(none)
|
------------------------------ |
Hypomesus olidus |
(none)
|
------------------------------ |
Hypomesus pretiosus |
(none)
|
GCTTTGCCATCAATCGGAAA---------- |
Hypomesus transpacificus |
(none)
|
GCTTTGCCATCAATCGGAAA---------- |
Mallotus villosus |
(none)
|
GCTTTGCCATCAATCGGAAATCCGAGCCCC |
Osmerus mordax |
(none)
|
GCTTTGCCATCAATCGGAAA---------- |
Osmerus dentex |
(none)
|
------------------------------ |
Osmerus eperlanus |
(none)
|
------------------------------ |
Spirinchus lanceolatus |
(none)
|
------------------------------ |
Spirinchus starksi |
(none)
|
GCTTTGCCTTCAATCGGAAA---------- |
Spirinchus thaleichthys |
(none)
|
------------------------------ |
Thaleichthys pacificus |
(none)
|
GCTTTGCCATCAATCGGAAA---------- |
Plecoglossus altivelis |
(none)
|
------------------------------ |
Columns
None of the columns has a description.