@ARTICLE{TreeBASE2Ref2187,
author = {Peter B. Heenan and Simon Joly and Peter J. Lockhart},
title = {A Pleistocene inter-tribal allopolyploidization event precedes the species radiation of Pachycladon (Brassicaceae) in New Zealand.},
year = {2009},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {The Southern Alps in New Zealand contain many herbaceous plant groups that have radiated during the Plicoene-Pleistocene. The species in these genera tend to be polyploid relative to their overseas close relatives, an observation of much interest given that hybridization and allopolyploidy have recently been suggested as a possible stimulus for adaptive radiation. We were interested to determine whether or not allopollyploidy was a feature of Pachycladon, a genus which is hypothesised to have adaptively diversified onto different geological substrates in the mountains of the South Island of New Zealand. Phylogenetic analyses of five single-copy nuclear genes show that Pachycladon species have two copies of each gene representing two highly diverged evolutionary lineages from the Brassicaceae. Molecular clock analyses of all loci suggest that the two genome copies in Pachycladon diverged 8 million years ago, and that the allopolyploid origin of the genus occurred during the Pleistocene between 1.6 and 0.8 million years ago. Thus, the hybridization event at the origin of the Pachycladon radiation is perhaps the most extreme example yet reported of successful hybridization between distantly related parents.}
}
Matrix 3402 of Study 2250

Citation title:
"A Pleistocene inter-tribal allopolyploidization event precedes the species radiation of Pachycladon (Brassicaceae) in New Zealand.".

This study was previously identified under the legacy study ID S2261
(Status: Published).
Matrices
Title: CAD5
Description: Legacy TreeBASE Matrix ID = M4294
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Lepidium apelatum clone4 |
(none)
|
AAAAACGACTTGGGCATGTCTAACTACCCC |
Lepidium apelatum clone3 |
(none)
|
AAAAATGATATGGGGATGTCTAATTACCCC |
Brassica rapa pekinensis |
(none)
|
AAAAACGATCTCGGCACGTCTAACTACCCC |
Capsella bursapastoris clone1 |
(none)
|
AAAAATGATCTTGGCATGTCTAACTACCCT |
Pachycladon exilis B |
(none)
|
AAAAACGATATGGGCATGTCTAATTACCCC |
Pachycladon fastigiata B |
(none)
|
AAAAACGATCTGGGCATGTCTAATTACCCC |
Pachycladon fastigiata A |
(none)
|
--AAATGATCTGGGCATGTCTAACTACCCC |
Pachycladon exilis A |
(none)
|
AAAAATGATCTGGGCATGTCTAACTACCCC |
Olimarabidopsis cabulica |
(none)
|
AAAAATGACCTCGGCATGTCTAATTACCCT |
Crucihimalaya mollissima |
(none)
|
--AAATGATCTGGGCATGTCTAACTACCCC |
Transberingia bursifolia bursifolia |
(none)
|
AAAAATGATCTGGGCATGTCTAACTACCCC |
Boechera holboellii |
(none)
|
AAAAATGATCTGGGCATGTCTAACTACCCC |
Arabidopsis thaliana |
(none)
|
AAAAATGATCTTGGCATGTCTAATTACCCC |
Arabidopsis lyrata lyrata |
(none)
|
AAAAATGATCTTGGCATGTCTAACTACCCC |
Columns
None of the columns has a description.