Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 48034 of Study 23586
Citation title: "Lactifluus (Russulaceae) in the Lesser Antilles: multi-gene phylogeny and morphological revision reveal high endemic diversity".
Study name: "Lactifluus (Russulaceae) in the Lesser Antilles: multi-gene phylogeny and morphological revision reveal high endemic diversity".
This study is part of submission 23586
(Status: Published).
Matrices
Title: Lactifluus Lesser Antilles ITS LSU RPB1 RPB2
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Lactifluus cf. nebulosus LD 15.059 Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus nebulosus LD_15.031_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus nebulosus LD_15.036_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. nebulosus LD 15.061 Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus aff. nebulosus PAM.Mart12.90 Martinique | (none) | ------------------------------ |
| Lactifluus nebulosus J.P._Fiard_828A_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus aff. nebulosus PAM Mart 05.091 Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. LD 15.066 Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus aff. sp. RC Guad11.023 Guadeloupe | (none) | ------------------------------ |
| Lactifluus nebulosus GUA.104_Virgin_Islands | (none) | ---------------------TTTCCGTAG |
| Lactifluus coccolobae OKM.2740_Puerto_Rico | (none) | ---------------------TTTCCGTAG |
| Lactifluus chiapanensis VMB_4374A_Mexico | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus caribaeus CL_MART06.014_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus caribaeus J.P._Fiard_818A_Martinique | (none) | ------------GTAACAAGGTTTCCGTAG |
| Lactifluus caribaeus paratype_J.P._Fiard_827B_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. murinipes LD 15.018 Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. murinipes LD 15.057 Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. castaneibadius CL MART06.019 Martinique | (none) | ------------------------------ |
| Lactifluus cf. murinipes LD 15.054 Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus cf. castaneibadius LD 15.032 Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus cf. murinipes LD 15.015 Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus cf. murinipes LD 15.020 Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus cf. murinipes F.1890 Martinique | (none) | ------------------------------ |
| Lactifluus castaneibadius J.P._Fiard_837A_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus murinipes J.P._Fiard_849A_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus PAM_Mart_11.013_Martinique | (none) | ------------------------------ |
| Lactifluus putidus PAM.Mart12.88_Martinique | (none) | ------------------------------ |
| Lactifluus putidus RC_Mart10_011_Martinique | (none) | ------------------------------ |
| Lactifluus putidus RC_Guad_06.005_Guadeloupe | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.006_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.017_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.040_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.041_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.065_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.002_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.011_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.033_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.034_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus LD_15.030_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus RC_Mart_05.110_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus PAM_Mart_05.030_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus putidus RC_Mart_03.001_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus aff. putidus PAM Mart 05.085 Martinique | (none) | ------------------------------ |
| Lactifluus putidus LD_15.004_Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus putidus LD_15.039_Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus putidus PAM.Mart12.103_Martinique | (none) | ------------------------------ |
| Lactifluus putidus LD_15.062_Martinique | (none) | GAAGTAAAAGTC{AG}{AT}AACAAGGTTT |
| Lactifluus panuoides RC_Mart_03.077_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus panuoides RC_Guy10_024_French_Guiana | (none) | ------------------------------ |
| Lactifluus panuoides D.N._Pegler_3133_Guadeloupe | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus panuoides paratype_R.W.G._Dennis_109A_Trinidad_And_Tobago | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus panuoides CL_GUAD06.045_Guadeloupe | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. G3185 French Guiana | (none) | ------------------------------ |
| Lactifluus sp. RC Guad 05.029 Guadeloupe | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. RC Guad 08.042 Guadeloupe | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. JLC 06031001 French Guiana | (none) | ------------------------------ |
| Lactifluus aff. phlebonemus EDC 12.023 Cameroon | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus foetens ADK_2840_Benin | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus luteolus AV_05.253_United_States | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. gymnocarpus EDC 12.047 Cameroon | (none) | GAAGTAAAAGTCGTA{AC}CAAGGTTTCCG |
| Lactifluus rufomarginatus ADK_3011_Benin | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cocosmus ADK_4462_Togo | (none) | -AAGTAAAAGTTGTAACAAGGTTTCCGTAG |
| Lactifluus sp. TH7880 Guyana | (none) | ------------------------------ |
| Lactifluus annulifer TH_9014_Guyana | (none) | ------------------------------ |
| Lactifluus sp. RC Guy 09.004bis French Guiana | (none) | ------------------------------ |
| Lactifluus aff. annulifer G4819 French Guiana | (none) | ------------------------------ |
| Lactifluus sp. G4727 French Guiana | (none) | ------------------------------ |
| Lactifluus aff. sp. MR Guy 13.032 French Guiana | (none) | ------------------------------ |
| Lactifluus sp. MCA3938 Guyana | (none) | ------------------------------ |
| Lactifluus subiculatus TH7922_Guyana | (none) | ----TAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. MCA 4276 Guyana | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus subiculatus paratype_SLM_10114_Guyana | (none) | -----AAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus aff. venezuelanus RC Guy 12.007 French Guiana | (none) | ------------------------------ |
| Lactifluus venezuelanus RC_Mart_03.120_Martinique | (none) | ------------------------------ |
| Lactifluus venezuelanus F.1980_Martinique | (none) | ------------------------------ |
| Lactifluus venezuelanus PAM_Guad_10.036_Guadeloupe | (none) | ------------------------------ |
| Lactifluus venezuelanus RC_Guad11.017_Guadeloupe | (none) | ------------------------------ |
| Lactifluus venezuelanus PAM_Guad_10.037_Guadeloupe | (none) | ------------------------------ |
| Lactifluus venezuelanus RC_Guad_03.048_Guadeloupe | (none) | ------------------------------ |
| Lactifluus sp. MR.GUY.14.195 French Guiana | (none) | ------------------------------ |
| Lactifluus sp. G4836 French Guiana | (none) | ------------------------------ |
| Lactifluus sp. MAN MAN919 Brazil | (none) | ------------------------------ |
| Lactifluus sp G4797_French_Guyana | (none) | ------------------------------ |
| Lactifluus neotropicus R.W.G._Dennis_97_Trinidad_And_Tobago | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus edulis FN_05.628_Malawi | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cyanovirescens JD_988_Congo | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus multiceps TH9154_Guyana | (none) | ------------------------------ |
| Lactifluus madagascariensis BB_99.409_Madagascar | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. densifolius AV 11.111 Tanzania | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus cf. rubroviolascens EDC 12.051 Cameroon | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus pegleri PAM_Mart_05.088_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus pegleri PAM.Mart12.54_Martinique | (none) | ------------------------------ |
| Lactifluus pegleri PAM.Mart12.91_Martinique | (none) | ------------------------------ |
| Lactifluus pegleri LD_15.042_Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus pegleri LD_15.014_Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus pegleri LD_15.049_Martinique | (none) | GAAGTAAA{AT}GTCGTAACAAGGTTTCCG |
| Lactifluus pegleri paratype_J.P._Fiard_821B_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus veraecrucis M_8025_Mexico | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. MCA 3937 Guyana | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. RC Guy 09.036 French Guiana | (none) | ------------------------------ |
| Lactifluus hygrophoroides AV_05.251_United_States | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus sp. MR Guy 13.145 French Guiana | (none) | ------------------------------ |
| Lactifluus leoninus DS_07.454_Thailand | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus brunellus TH_9130_Guyana | (none) | ------------------------------ |
| Lactarius tenellus ADK_3598_Benin | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactarius miniatescens AV_11.177_Togo | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactarius fuliginosus MTB_97.24_Sweden | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactarius olympianus ED_08.018_United_States | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactarius hatsudake FH_12.052_Thailand | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactarius ferrugineus J.P._Fiard_805A_Martinique | (none) | GAAGTAAAAGTCGTAACAAGGTTTCCGTAG |
| Lactifluus chamaeleontinus JD_946_Congo | (none) | ------------------------------ |
| Lactifluus aurantiifolius AV_94.063_Burundi | (none) | --------------------GTTTCCGTAG |
| Lactifluus xerampelinus TS_1116_Tanzania | (none) | --------------------------GTAG |
| Lactifluus clarkeae MN_2004002_Australia | (none) | ------------------------------ |
| Lactifluus deceptivus TENN_065854_United_States | (none) | ------------------------------ |
| Lactarius scrobiculatus JN_2001.058_Slovakia | (none) | ------------------------------ |
Columns
None of the columns has a description.
