@ARTICLE{TreeBASE2Ref18172,
author = {Martin F. Wojciechowski and Michael J. Sanderson and Bruce G. Baldwin and Michael J Donoghue},
title = {Monophyly of aneuploid Astragalus (Fabaceae): Evidence from nuclear ribosomal DNA internal transcribed spacer sequences.},
year = {1993},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {American Journal of Botany},
volume = {80},
number = {},
pages = {711--722},
abstract = {Evolutionary relationships within Astragalus L. (Fabaceae) were inferred from nucleotide sequence variation in nuclear ribosomal DNA of both New World and Old World species. The internal transcribed spacer regions (ITS) of 18S-26S nuclear ribosomal DNA from representatives of 26 species of Astragalus, three species of Oxytropis DC., and two outgroup taxa were analyzed by polymerase chain reaction amplification and direct DNA sequencing. The length of the ITS I region within these taxa varied from 221 to 231 bp, while ITS 2 varied in length from 207 to 217 bp. Of the aligned, unambiguous positions, approximately 34% were variable in each spacer region. In pairwise comparisons among Astragalus species and outgroup taxa, sequence divergence at these sites ranged from 0 to 1 8.8% in ITS I and from 0 to 21.7% in ITS 2. Parsimony analyses of these sequences resulted in a well-resolved phylogeny that is highly concordant with previous cytogenetic and chloroplast DNA evidence for a major phylogenetic division in the genus. These data suggest that the New World aneuploid species of Astragalus form a monophyletic but morphologically cryptic group derived from euploid species of Old World (Eurasian) origin, which are consequently paraphyletic.}
}
Matrix 1579 of Study 236

Citation title:
"Monophyly of aneuploid Astragalus (Fabaceae): Evidence from nuclear ribosomal DNA internal transcribed spacer sequences.".

This study was previously identified under the legacy study ID S2x6x96c17c48c00
(Status: Published).
Matrices
Title: Platanus exon3
Description: Legacy TreeBASE Matrix ID = M2428
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Platanus wrightii |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Platanus racemosa |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Platanus orientalis |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Platanus occidentalis |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Platanus mexicana |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Platanus kerrii |
(none)
|
GTGACGAACCAGGTATTCAGATATGCAAAA |
Eschscholzia californica |
(none)
|
GTGACGAATCAAGTATTTAGGTTTGCCAAG |
Vitis vinifera |
(none)
|
GTGACGAACCAGGTGTTTAGATACGCGAAG |
Trochodendron aralioides |
(none)
|
GTGACAAACCAGGTGTTTAGATACGCGAAG |
Peperomia sp |
(none)
|
GTGACGAACCAGGTGTTCAGATATGCAAAG |
Oryza sativa |
(none)
|
GTGACGAACCAGGTGTTCCGGTACGCGAAG |
Nymphaea ororata |
(none)
|
GTAACGAACCAGGTGTTCAGGTACGCCAAG |
Columns
None of the columns has a description.