@ARTICLE{TreeBASE2Ref31396,
author = {Pedro W. Crous and Johannes (Ewald) Zacharias Groenewald},
title = {Fungal Planet description sheets: 1112-1181},
year = {2020},
keywords = {ITS nrDNA barcodes, LSU, new taxa, systematics},
doi = {10.3767/persoonia.2020.45.10},
url = {http://dx.doi.org/10.3767%2Fpersoonia.2020.45.10},
pmid = {34456379},
journal = {Persoonia},
volume = {45},
number = {},
pages = {251--409},
abstract = {Novel species of fungi described in this study include those from various countries as follows: Australia, Austroboletus asper on soil, Cylindromonium alloxyli on leaves of Alloxylon pinnatum, Davidhawksworthia quintiniae on leaves of Quintinia sieberi, Exophiala prostantherae on leaves of Prostanthera sp., Lactifluus lactiglaucus on soil, Linteromyces quintiniae (incl. Linteromyces gen. nov.) on leaves of Quintinia sieberi, Lophotrichus medusoides from stem tissue of Citrus garrawayi, Mycena pulchra on soil, Neocalonectria tristaniopsidis (incl. Neocalonectria gen. nov.) and Xyladictyochaeta tristaniopsidis on leaves of Tristaniopsis collina, Parasarocladium tasmanniae on leaves of Tasmannia insipida, Phytophthora aquae-cooljarloo from pond water, Serendipita whamiae as endophyte from roots of Eriochilus cucullatus, Veloboletus limbatus (incl. Veloboletus gen. nov.) on soil. Austria, Cortinarius glaucoelotus on soil. Bulgaria, Suhomyces rilaensis from the gut of Bolitophagus interruptus found on a Polyporus sp. Canada, Cantharellus betularum among leaf litter of Betula, Penicillium saanichii from house dust. Chile, Circinella lampensis on soil, Exophiala embothrii from rhizosphere of Embothrium coccineum. China, Colletotrichum cycadis on leaves of Cycas revoluta. Croatia, Phialocephala melitaea on fallen branch of Pinus halepensis. Czech Republic, Geoglossum jirinae on soil, Pyrenochaetopsis rajhradensis from dead wood of Buxus sempervirens. Dominican Republic, Amanita domingensis on litter of deciduous wood, Melanoleuca dominicana on forest litter. France, Crinipellis nigrolamellata (Martinique) on leaves of Pisonia fragrans, Talaromyces pulveris from bore dust of Xestobium rufovillosum infesting floorboards. French Guiana, Hypoxylon hepaticolor on dead corticated branch. Great Britain, Inocybe ionolepis on soil. India, Cortinarius indopurpurascens among leaf litter of Quercus leucotrichophora. Iran, Pseudopyricularia javanii on infected leaves of Cyperus sp., Xenomonodictys iranica (incl. Xenomonodictys gen. nov.) on wood of Fagus orientalis. Italy, Penicillium vallebormidaense from compost. Namibia, Alternaria mirabibensis on plant litter, Curvularia moringae and Moringomyces phantasmae (incl. Moringomyces gen. nov.) on leaves and flowers of Moringa ovalifolia, Gobabebomyces vachelliae (incl. Gobabebomyces gen. nov.) on leaves of Vachellia erioloba, Preussia procaviae on dung of Procavia capensis. Pakistan, Russula shawarensis from soil on forest floor. Russia, Cyberlindnera dauci from Daucus carota. South Africa, Acremonium behniae on leaves of Behnia reticulata, Dothiora aloidendri and Hantamomyces aloidendri (incl. Hantamomyces gen. nov.) on leaves of Aloidendron dichotomum, Endoconidioma euphorbiae on leaves of Euphorbia mauritanica, Eucasphaeria proteae on leaves of Protea neriifolia, Exophiala mali from inner fruit tissue of Malus sp., Graminopassalora geissorhizae on leaves of Geissorhiza splendidissima, Neocamarosporium leipoldtiae on leaves of Leipoldtia schultzii, Neocladosporium osteospermi on leaf spots of Osteospermum moniliferum, Neometulocladosporiella seifertii on leaves of Combretum caffrum, Paramyrothecium pituitipietianum on stems of Grielum humifusum, Phytopythium paucipapillatum from roots of Vitis sp., Stemphylium carpobroti and Verrucocladosporium carpobroti on leaves of Carpobrotus quadrifolius, Suttonomyces cephalophylli on leaves of Cephalophyllum pilansii. Sweden, Coprinopsis rubra on cow dung, Elaphomyces nemoreus from deciduous woodlands. Spain, Polyscytalum pini-canariensis on needles of Pinus canariensis, Pseudosubramaniomyces septatus from stream sediment, Tuber lusitanicum on soil under Quercus suber. Thailand, Tolypocladium flavonigrum on Elaphomyces sp. USA, Chaetothyrina spondiadis on fruits of Spondias mombin, Gymnascella minnisii from bat guano, Juncomyces patwiniorum on culms of Juncus effusus, Moelleriella puertoricoensis on scale insect, Neodothiora populina (incl. Neodothiora gen. nov.) on stem cankers of Populus tremuloides, Pseudogymnoascus palmeri from cave sediment. Vietnam, Cyphellophora vietnamensis on leaf litter, Tylopilus subotsuensis on soil in montane evergreen broadleaf forest. Morphological and culture characteristics are supported by DNA barcodes.}
}
Matrix 60798 of Study 27179

Citation title:
"Fungal Planet description sheets: 1112-1181".

Study name:
"Fungal Planet description sheets: 1112-1181".

This study is part of submission 27179
(Status: Published).
Matrices
Title: Fig. 8. Overview Saccharomycetes LSU alignment
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Backusella lamprospora MH866118.1 |
(none)
|
------------------------------ |
| Cyberlindnera dauci MT636878.1 |
(none)
|
TTTGACCTCAAATCAGGTAGGACTACCCGC |
| Cyberlindnera galapagoensis KJ020281.2 |
(none)
|
TTTGACCTCAAATCAGGTAGGACTACCCGC |
| Candida mengyuniae EU043158.1 |
(none)
|
------------------------------ |
| Cyberlindnera saturnus EF550316.1 |
(none)
|
------------------------------ |
| Cyberlindnera suaveolens EU544674.1 |
(none)
|
------------------------------ |
| Cyberlindnera sargentensis HM461618.1 |
(none)
|
------------------------------ |
| Cyberlindnera mrakii EF550317.1 |
(none)
|
------------------------------ |
| Cyberlindnera subsufficiens EF550318.1 |
(none)
|
------------------------------ |
| Suhomyces taliae KY106790.1 |
(none)
|
------------------------------ |
| Suhomyces tanzawaensis KY106794.1 |
(none)
|
------------------------------ |
| Suhomyces atakaporum KY106307.1 |
(none)
|
------------------------------ |
| Suhomyces panamericanus JQ025407.1 |
(none)
|
------------------------ACCCGC |
| Suhomyces terraborum NG_054809.1 |
(none)
|
------------------------------ |
| Suhomyces yuchorum NG_054786.1 |
(none)
|
------------------------------ |
| Suhomyces chickasaworum NG_054784.1 |
(none)
|
------------------------------ |
| Suhomyces bolitotheri NG_054783.1 |
(none)
|
------------------------------ |
| Suhomyces bolitophagii HM627113.1 |
(none)
|
------------------------------ |
| Suhomyces bolitophagii HM627116.2 |
(none)
|
------------------------------ |
| Suhomyces bolitophagii HM627061.2 |
(none)
|
------------------------------ |
| Candida albicans U45776.1 |
(none)
|
------------------------------ |
| Candida gigantensis AY520316.1 |
(none)
|
------------------------------ |
| Candida tropicalis KX198669.1 |
(none)
|
TTTGACCTCAAATCAGGTAGGACTACCCGC |
| Candida sojae KJ722420.1 |
(none)
|
--------------AGGTAGGACTACCCGC |
| Candida neerlandica NG_054776.1 |
(none)
|
------------------------------ |
| Candida frijolesensis NG_054802.1 |
(none)
|
------------------------------ |
| Candida labiduridarum NG_042506.1 |
(none)
|
------------------------------ |
| Candida tetrigidarum NG_042507.1 |
(none)
|
------------------------------ |
| Candida prachuapensis NG_054767.1 |
(none)
|
------------------------------ |
| Candida saraburiensis NG_054769.1 |
(none)
|
------------------------------ |
| Candida pseudoviswanathii KM586735.1 |
(none)
|
------------------------------ |
| Candida pellucida MN908679.1 |
(none)
|
TTTGACCTCAAGTCAGGTAGGACTACCCGC |
| Candida viswanathii U45752.1 |
(none)
|
------------------------------ |
Columns
None of the columns has a description.