@ARTICLE{TreeBASE2Ref15776,
author = {S. Blair Hedges and Kirk D. Moberg and Linda R. Maxson},
title = {Tetrapod phylogeny inferred from 18s and 28s ribosomal RNA sequences and a review of the evidence for amniote relationships.},
year = {1990},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Biology and Evolution},
volume = {7},
number = {6},
pages = {607--633},
abstract = {The 18S ribosomal RNAs of 21 tetrapods were sequenced and aligned with five published tetrapod sequences. When the coelacanth was used as an outgroup, Lissamphibia (living amphibians) and Amniota (amniotes) were found to be statistically sign)ficant monophyletic groups. Although little resolution was obtained among the lissamphibian taxa, the amniote sequences support a sister-group relationship between birds and mammals. Portions of the 28S ribosomal RNA ( rRNA ) molecule in 11 tetrapods also were sequenced, although the phylogenetic results were inconclusive. In contrast to previous studies, deletion or down-weighting of base-paired sites were found to have little effect on phylogenetic relationships. Molecular evidence for amniote relationships is reviewed, showing that three genes (beta-hemoglobin, myoglobin, and 18S rRNA) unambiguously support a birdmammal relationship, compared with one gene (histone H2B) that favors a birdcrocodilian clade. Separate analyses of four other genes ( alpha-crystallin A, alphahemoglobin, insulin, and 28S rRNA) and a combined analysis of all sequence data are inconclusive, in that different groups are defined in different analyses and none are strongly supported. It is suggested that until sequences become available from a broader array of taxa, the molecular evidence is best evaluated at the level of individual genes, with emphasis placed on those studies with the greatest number of taxa and sites. When this is done, a bird-mammal relationship is most strongly supported. When regarded in combination with the morphological evidence for this association, it must be considered at least as plausible as a bird-crocodilian relationship.}
}
Matrix 2017 of Study 362

Citation title:
"Tetrapod phylogeny inferred from 18s and 28s ribosomal RNA sequences and a review of the evidence for amniote relationships.".

This study was previously identified under the legacy study ID S296
(Status: Published).
Matrices
Title: Fig. A1
Description: Legacy TreeBASE Matrix ID = M336
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Oryctolagus cuniculus |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Homo sapiens |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Rattus norvegicus |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Mus musculus |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Gallus gallus |
(none)
|
--CC-GGTTGATCCTGCCAGTAGCA---GC |
Turdus migratorius |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCAT--GC |
Alligator mississippiensis |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCATA-GC |
Sceloporus undulatus |
(none)
|
----------------------------GC |
Heterodon platyrhinos |
(none)
|
--CCT-GTTGATCCTGCCAG-AGCA---GC |
Trachemys scripta |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCATA-GC |
Typhlonectes natans |
(none)
|
----TGGTTGATCCTGCCAGTAGCA---GC |
Hypogeophis rostratus |
(none)
|
------------------------------ |
Grandisonia alternans |
(none)
|
--CCT-GTT-ATCCT-CCAG-AGCA---GC |
Ichthyophis bannanicus |
(none)
|
------------------------------ |
Plethodon yonhalossee |
(none)
|
-----GGTT-ATCCTGCCAG-AGCA---GC |
Ambystoma mexicanum |
(none)
|
----TGGTTGATCCTGCCAGTAGCA---GC |
Amphiuma tridactylum |
(none)
|
--CCT-GTTGATCCTGCCAG-AGCA---GC |
Siren intermedia |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCA---GC |
Gastrophryne carolinensis |
(none)
|
---CTGGTTGATCCTGCCAGTAGC----GC |
Hyla cinerea |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCA-A--C |
Bufo valliceps |
(none)
|
------------------------------ |
Eleutherodactylus cuneatus |
(none)
|
--CCTGGTTGATCCTGCCAGTAGCA---GC |
Nesomantis thomasseti |
(none)
|
--CCT-GTT-ATCCTGCCAGTAGCT---GC |
Scaphiopus holbrooki |
(none)
|
------GTT-AT--TGC-AG--G-----GC |
Xenopus laevis |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Discoglossus pictus |
(none)
|
----TGGTTGATCCTGCCAGTAGCATA--C |
Latimeria chalumnae |
(none)
|
TACCTGGTTGATCCTGCCAGTAGCATATGC |
Columns
None of the columns has a description.