@ARTICLE{TreeBASE2Ref16540,
author = {Patrick Mardulyn and Michel C. Milinkovitch and Jacques M. Pasteels},
title = {Phylogenetic analyses of DNA and allozyme data suggest that Gonioctena leaf beetles (Coleoptera; Chrysomelidae) experienced convergent evolution in their history of host-plant family shifts.},
year = {1997},
keywords = {Allozymes; Chrysomelidae; coevolution; Gonioctena; host-plant shifts; insect-plant interactions; mitochondrial DNA; molecular phylogenetics},
doi = {10.1093/sysbio/46.4.722},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {46},
number = {4},
pages = {722--747},
abstract = {A phylogenetic analysis of the genus Gonioctena (Coleoptera, Chrysomelidae) based on allozyme data (17 loci) and mitochondrial DNA sequence data (three gene fragments, 1,391 sites) was performed to study the evolutionary history of host-plant shifts among these leaf beetles. This chrysomelid genus is characteristically associated with a high number of different plant families. The diverse molecular data gathered in this study are to a large extent congruent, and the analyses provide a well-supported phylogenetic hypothesis to address questions about the evolution of host-plant shifts in the genus Gonioctena. The most-parsimonious reconstruction of the ancestral host-plant associations, based on the estimated phylogeny, suggests that the Fabaceae was the ancestral host-plant family of the genus. Although most of the host-plant shifts (between different host species) in Gonioctena have occurred within the same plant family or within the same plant genus, at least eight shifts have occurred between hosts belonging to distantly related and chemically dissimilar plant families. In these cases, host shifts may have been simply directed toward plant species available in the environment. Yet, given that two Gonioctena lineages have independently colonized the same three new plant families, including four of the same new genera, some constraints are likely to have limited the different possibilities of interfamilial host-plant shifts.}
}
Matrix 2677 of Study 381

Citation title:
"Phylogenetic analyses of DNA and allozyme data suggest that Gonioctena leaf beetles (Coleoptera; Chrysomelidae) experienced convergent evolution in their history of host-plant family shifts.".

This study was previously identified under the legacy study ID S324
(Status: Published).
Matrices
Title: 16S Alignment 3
Description: Legacy TreeBASE Matrix ID = M412
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Gonioctena viminalis |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena olivacea |
(none)
|
?GACCCAATA-TTTTAGCTTCTACACCAAA |
Gonioctena rufipes |
(none)
|
???CCTAATA-TTTCAGCTTCTGCACCGAA |
Gonioctena linnaeana |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena variabilis |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena fornicata a |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena fornicata b |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena occidentalis |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena interposita 1 |
(none)
|
AGACCTAATC-TTTCAGCTTCTGCACCAAA |
Gonioctena interposita 2 |
(none)
|
AGACCTAATC-TTTCAGCTTCTGCACCAAA |
Gonioctena intermedia |
(none)
|
AGACCTAATT-TTTTAGCTTCTACACCAAA |
Gonioctena quinquepunctata |
(none)
|
?CACCTAATT-TTTTAGCTTCTACACCAAA |
Gonioctena holdausi |
(none)
|
AGACCTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena pallida 1 |
(none)
|
?GACCTAATA-TTTCAGCTTCTACACCAAA |
Gonioctena pallida 2 |
(none)
|
?GACCTAATA-TTTCAGCTTCTACACCAAA |
Gonioctena tredecimmaculata |
(none)
|
????CTAATA-TTTTAGCTTCTACACCAAA |
Gonioctena nigroplagiata |
(none)
|
AGACCTAATT-TTTTAGCTTCTACACCAAA |
Gonioctena kamikawai |
(none)
|
AGACCTAATA-TTTCAGCTTCTACACCAAA |
Gonioctena rubripennis |
(none)
|
AGACCTAATA-TCCTAGCTTCTACACCAAA |
Oreina cacaliae |
(none)
|
AGACCTAATATTTTTAGCTTCTACACCAAA |
Chrysomela tremula |
(none)
|
AGACCTAATA-TTTTAGCTCCTACACCAAA |
Columns
None of the columns has a description.