@ARTICLE{TreeBASE2Ref14922,
author = {David C. Cannatella and David M Hillis and Paul T. Chippindale and Lee Weight and A. Stanley Rand and Michael J. Ryan},
title = {Phylogeny of frogs of the Physalaemus pustulosus species group with an examination of data incongruence.},
year = {1998},
keywords = {Advertisement calls; behavior; combined-data analysis; data partitions; frogs; Leptodactylidae; Physalaemus; sensory exploitation hypothesis},
doi = {10.1080/106351598260932},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {47},
number = {2},
pages = {311--335},
abstract = {Characters derived from advertisement calls, morphology, allozymes, and the sequences of the small subunit of the mitochondrial ribosomal gene (12S) and the COI mitochondrial gene were used to estimate the phylogeny of frogs of the Physalaemus pustulosus group (Leptodactylidae). The combinability of these data partitions was assessed in several ways: measures of phylogenetic signal, character support for trees, congruence of tree topologies, compatibility of data partitions with suboptimal trees, and homogeneity of data partitions. Combined parsimony analysis of all data equally weighted yielded the same tree as the 12S partition analyzed under parsimony and maximum likelihood. The COI, allozyme, and morphology partitions were generally congruent and compatible with the tree derived from combined data. The call data were significantly different from all other partitions, whether considered in terms of tree topology alone, partition homogeneity, or compatibility of data with trees derived from other partitions. The lack of effect of the call data on the topology of the combined tree is probably due to the small number of call characters. The general incongruence of the call data with other data partitions is consistent with the idea that the advertisement calls of this group of frogs are under strong sexual selection. Advertisement calls; behavior; combined-data analysis; data partitions; frogs; Leptodactylidae;Physalaemus; sensory exploitation hypothesis.}
}
Matrix 2080 of Study 394

Citation title:
"Phylogeny of frogs of the Physalaemus pustulosus species group with an examination of data incongruence.".

This study was previously identified under the legacy study ID S340
(Status: Published).
Matrices
Title: Appendix COI
Description: Legacy TreeBASE Matrix ID = M447
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Physalaemus sp. A |
(none)
|
CACCCTGAAGTTTATATTCTAATTCTTCCA |
Physalaemus ephippifer |
(none)
|
CACCCTGAAGTTTATATCCTTATTCTTCCA |
Physalaemus enesefae |
(none)
|
CATCCTGAAGTTTACATCCTTATTCTACCA |
Physalaemus pustulosus |
(none)
|
CACCCAGAAGTTTATATTTTAATTCTCCCA |
Physalaemus petersi |
(none)
|
CATCCAGAAGTTTACATCTTAATTCTCCCT |
Physalaemus cf. freibergi |
(none)
|
CACCCAGAAGTATATATTTTAATTCTCCCC |
Physalaemus coloradorum |
(none)
|
CATCCAGAAGTTTATATCCTTATTCTCCCC |
Physalaemus pustulatus |
(none)
|
CACCCAGAAGTTTACATTCTCATTCTCCCG |
Physalaemus caicai |
(none)
|
CACCCAGAAGTCTATATTCTTATTTTACCC |
Physalaemus sp. C |
(none)
|
CACCCAGAAGTCTATATTCTTATCTTACCC |
Columns
None of the columns has a description.