@ARTICLE{TreeBASE2Ref14554,
author = {Seon Sook An and B. Mpps and Klaus Weber and Debashish Bhattacharya},
title = {The origin and evolution of green algal and plant actins.},
year = {1999},
keywords = {},
doi = {},
url = {http://mbe.oxfordjournals.org/cgi/content/abstract/16/2/275},
pmid = {},
journal = {Molecular Biology and Evolution},
volume = {16},
number = {},
pages = {275--285},
abstract = {The Viridiplantae are subdivided into two groups: the Chlorophyta, which includes the Chlorophyceae, Trebouxiophyceae, Ulvophyceae. and Prasinophyceae; and the Streptophyta, which includes die Charophyceae and all land plants. Within the Streptophyta, the actin genes of the angiosperms diverge nearly simultaneously fi om each other before the separation of monocots and dicots. Previous evolutionary analyses have provided limited insights into the gene duplications that have produced these complex gene families. We address the origin and diversification of land plant actin genes by studying the phylogeny of actins within the green algae, ferns, and fern allies. Partial genomic sequences or cDNAs encoding actin were characterized from Cosmarium botrytis (Zygnematales), Selaginella apoda (Selaginellales), Anemia phyllitidis (Polypodiales), and Psilotum triquetrum (Psilotales). Selaginella contains at least two actin genes. One sequence (Ac2) diverges within a group of fern sequences that also includes the Psilotum Ac1 actin gene and one gymnosperm sequence (Cycas revoluta Cyc3). This clade is positioned outside of the angiosperm actin gene radiation. The second Selaginella sequence (Ac1) is the sister to all remaining land plant actin sequences, although the internal branches in this portion of the tree are ver!: short. Use of complete actin-coding regions in phylogenetic analyses provides support for the separation of angiosperm actins into two classes. N-terminal signature sequence analyses support these groupings. One class (VEG) includes actin genes that are often expressed in vegetative structures. The second class (REP) includes actin genes that trace their ancestry within the vegetative actins and contains members that are largely expressed in reproductive structures. Analysis of intron positions within actin genes shows that sequences from both Selaginella and Cosmarium contain the conserved 20-3, 152-1, and 356-3 introns found in many members of the Streptophyta. In addition, the Cosmarium actin gene contains a novel intron at position 76-1.}
}
Matrix 16007 of Study 414

Citation title:
"The origin and evolution of green algal and plant actins.".

This study was previously identified under the legacy study ID S365
(Status: Published).
Matrices
Title: ITS Caloplaca ulcerosa group
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Caloplaca citrina DQ173226 |
(none)
|
AGAGAGGGACGTGCGGTTGCTTGCGGCCCA |
| Caloplaca citrina DQ173239 |
(none)
|
AGAG-GGGACATGCGGCTGCTCGCGGCCCA |
| Caloplaca ulcerosa EU639623 2 |
(none)
|
------------------------------ |
| Caloplaca sp. aff. C. ulcerosa USA1 GU080298 |
(none)
|
AGAGCGGG-CAGGC--TT---CACGGCT-G |
| Caloplaca sp. aff. C. ulcerosa USA 2 |
(none)
|
AGAGCGGG-CAGGC--TT---CACGGCT-G |
| Caloplaca sp. aff. C. ulcerosa USA3 |
(none)
|
AGAGCGGG-CAGGC--TT---CACGGCT-G |
| Caloplaca substerilis Austria1 GU080299 |
(none)
|
AGAGCGGG-CAGGC--TT---TACGGCC-G |
| Caloplaca substerilis Austria2 |
(none)
|
AGAGCGGG-CAGGC--TT---TACGGCC-G |
| Caloplaca substerilis Bulgaria |
(none)
|
AGAGCGGG-CAGGC--TT---CGCGGCT-G |
| Caloplaca ulcerosa GU080293 |
(none)
|
AGAG-GGGTCCGGC--TT---CGCGGCC-G |
| Caloplaca ulcerosa GU080294 |
(none)
|
AGAG-GGGTCAGGC--TT---CGCGGCC-G |
| Caloplaca ulcerosa EU639623 |
(none)
|
AGAG-GGG?CAGGC--TT---CGCGGCC-G |
| Caloplaca ulcerosa GU080295 |
(none)
|
AGAG-GGGTCAGGC--TT---CGCGGCC-G |
| Caloplaca ulcerosa GU080296 |
(none)
|
AGAG-GGGTCGGGC--TT---?GCGGCC-G |
| Caloplaca ulcerosa GU080297 |
(none)
|
AGAG-GGGTCAGGC--TT---CGCGGCC-G |
| Caloplaca substerilis Czech Republic |
(none)
|
AGAGCGGG-CAGGC--TT---CGCGGCT-G |
| Caloplaca substerilis Slovakia |
(none)
|
AGAGCGGG-CA{AG}GC--{AC}T---CAC |
Columns
None of the columns has a description.