@ARTICLE{TreeBASE2Ref17078,
author = {William H. Piel and Karen J. Nutt},
title = {One species or several? Discordant patterns of geographic variation between allozymes and mtDNA sequences among spiders in the genus Metepeira (Araneae: Araneidae).},
year = {2000},
keywords = {Metepeira; allozymes; mitochondrial ribosomal DNA; discordance; molecular systematics},
doi = {10.1006/mpev.1999.0763},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {15},
number = {3},
pages = {414--418},
abstract = {Paradoxically, an allozyme study of Metepeira spinipes (sensu lato) demonstrated extensive gene flow among four populations whose members are nevertheless morphologically and behaviorally distinct. Initially the authors tentatively concluded that the populations exhibited panmixis, and suggested that local environmental effects accounted for the apparent morphological and behavioral differences. However, they later concluded that such differences were too great to be accounted for by the environment alone, and that the four populations actually represented three different species. To confirm that the allozyme results were, in fact, artifactual, we reexamined the relationships among these populations by sequencing a portion of the 12S mtDNA ribosomal subunit. In contrast to the allozyme result, our results demonstrate good agreement between patterns of genetic and morphological/behavioral variation. We suggest (1) that the allozyme allele frequencies are homogenized by balancing selection, not gene flow as was previously concluded, and therefore (2) that this study provides another instance where inferences about population structures from allozyme data are misleading. Key Words.?Metepeira, allozymes, mitochondrial ribosomal DNA, discordance, molecular systematics.}
}
Matrix 2225 of Study 586

Citation title:
"One species or several? Discordant patterns of geographic variation between allozymes and mtDNA sequences among spiders in the genus Metepeira (Araneae: Araneidae).".

This study was previously identified under the legacy study ID S414
(Status: Published).
Matrices
Title: 12S mtDNA
Description: Legacy TreeBASE Matrix ID = M604
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Metepeira spinipes Durango |
(none)
|
ACCTGCCTATTAATCGATTTTCCACGATAT |
Metepeira spinipes Tepotzotlan |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Metepeira spinipes Toluca |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Metepeira atascadero Guanajuato |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Metepeira atascadero San Miguel |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Metepeira incrassata SLP |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Metepeira incrassata Fortin |
(none)
|
ACCTGCCTATTAATCGATTCTCCACGATAT |
Columns
None of the columns has a description.