@ARTICLE{TreeBASE2Ref17618,
author = {Michael J. Stanhope and Victor G. Waddell and Ole Madsen and Wilfried W. de Jong and S. Blair Hedges and Gregory C. Cleven and Diana Kao and Mark S. Springer},
title = {Molecular evidence for multiple origins of Insectivora and for a new order of endemic African insectivore mammals.},
year = {1998},
keywords = {},
doi = {},
url = {http://www.pnas.org/content/95/17/9967.abstract},
pmid = {},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {95},
number = {},
pages = {9967--9972},
abstract = {The traditional views regarding the mammalian order Insectivora are that the group descended froma single common ancestor and that it is comprised of the following families: Soricidae (shrews), Tenrecidae (tenrecs), Solenodonti-dae (solenodons), Talpidae (moles), Erinaceidae (hedgehogs and gymnures), and Chrysochloridae (golden moles). Here we present a molecular analysis that includes representatives of all six families of insectivores, as well as 37 other taxa representing marsupials, monotremes, and all but two orders of placental mammals. These data come from complete sequences of the mitochondrial 12S rRNA, tRNA-Valine, and 16S rRNA genes (2.6 kb). A wide range of different methods of phylogenetic analysis groups the tenrecs and golden moles (both endemic to Africa) in an all-African superordinal clade comprised of elephants, sire-nians, hyracoids, aardvark, and elephant shrews, to the exclusion of the other four remaining families of insectivores. Statistical analyses reject the idea of a monophyletic Insectivora as well as traditional concepts of the insectivore suborder Soricomorpha. These findings are supported by sequence analyses of several nuclear genes presented here: vWF, A2AB, and a- bhemoglobin. These results require that the order Insectivora be partitioned and that the two African families (golden moles and tenrecs) be placed in a new order. The African superordinal clade now includes six orders of placental mammals.}
}
Matrix 2240 of Study 599

Citation title:
"Molecular evidence for multiple origins of Insectivora and for a new order of endemic African insectivore mammals.".

This study was previously identified under the legacy study ID S427
(Status: Published).
Matrices
Title: vWF 18 taxa
Description: Legacy TreeBASE Matrix ID = M621
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Cavia porcellus |
(none)
|
------------------------------ |
Rattus norvegicus |
(none)
|
CAAGAGCCCGGAGGCCTGGTGGTACCCCCA |
Homo sapiens |
(none)
|
CAGGAGCCGGGAGGCCTGGTGGTGCCTCCC |
Oryctolagus cuniculus |
(none)
|
CAGGAACCGGGAGGCATGGTGGTACCCCCT |
Equus asinus |
(none)
|
??????????????CCTAGAGGTGCCTCCT |
Equus caballus |
(none)
|
?????????????????????????????? |
Bos taurus |
(none)
|
AAGGAGCCAGGAGGC------CCGCCCCCC |
Scalopus aquaticus |
(none)
|
??????????????ACTGGTGGCGCCCCCC |
Erinaceus europaeus |
(none)
|
?????????????????????????????? |
Echinops telfairi |
(none)
|
?????????GGAGGCCCCGGGCTGCCCCCC |
Amblysomus hottentotus |
(none)
|
CAGGAGCCAGGAGGTGGTGTGCTGCCCCCT |
Orycteropus afer |
(none)
|
CAGGAGTCAGGAATCCTTGTGCTGTCCCCC |
Elephantulus rufescens |
(none)
|
??GGAGCCAGGAGTCCTTGTGCTGCCTACA |
Elephas maximus |
(none)
|
CAGAGGCCGGGAGAGCTTGTGCCGCCCTCA |
Loxodonta africana |
(none)
|
CAGAGGGCGGGAAAGCTTGTGCCGCCCTCA |
Procavia capensis |
(none)
|
CAGGAGCCCAGT---ATTGTGCTGCCCCCA |
Trichechus manatus |
(none)
|
?????????????????????????????? |
Dugong dugong |
(none)
|
CAGGAGCCAGGAGGCCTTGCGCTTCCCCCA |
Columns
None of the columns has a description.