@ARTICLE{TreeBASE2Ref15430,
author = {Paul K. Flook and Stephan Klee and C. Hugh F. Rowell},
title = {Combined molecular phylogenetic analysis of the Orthoptera (Arthropoda, Insecta) and implications for their higher systematics.},
year = {1999},
keywords = {Combined analysis; insect phylogeny; molecular evolution; Orthoptera; ribosomal DNA},
doi = {10.1080/106351599260274},
url = {},
pmid = {12066707 },
journal = {Systematic Biology},
volume = {48},
number = {2},
pages = {233--253},
abstract = {A phylogenetic analysis of mitochondrial and nuclear rDNA sequences from species of all the superfamilies of the insect order Orthoptera (grasshoppers, crickets and relatives) confirmed that although mitochondrial sequences provided good resolution of the youngest superfamilies, nuclear rDNA sequences were necessary to separate the basal groups. To try to reconcile these data sets into a single fully resolved orthopteran phylogeny, we adopted consensus and combined data strategies. The consensus analysis produced a partially resolved tree, lacking several well-supported features of the individual analyses. However, this lack of resolution was explained by an examination of resampled data sets that identified the likely source of error as the relatively short length of the individual mitochondrial data partitions. In a subsequent comparison in which the mitochondrial sequences were initially combined, we observed less conflict. We then used two approaches to examine the validity of combining all of the data in a single analysis; comparative analysis of trees recovered from resampled data sets and the application of a randomization test. The results did not point to significant levels of heterogeneity in phylogenetic signal between the mitochondrial and nuclear data sets, and we therefore proceeded with a combined analysis. Reconstructing phylogenies under the minimum evolution and maximum likelihood optimality criteria, we examined monophyly of the major orthopteran groups using nonparametric and parametric bootstrap analysis and Kishino-Hasegawa tests. Our analysis suggests that phylogeny reconstruction under the ML criteria is the most discriminating approach for the combined sequences. The results indicate that the caeliferan Pneumoroidea and Pamphagoidea (as previously suggested) are polyphyletic. The Acridoidea is redefined to include all pamphagoid families other than the Pyrgomorphidae, which we propose should be accorded superfamily status. Combined analysis; insect phylogeny; molecular evolution; Orthoptera; ribosomal DNA.}
}
Matrix 2748 of Study 602

Citation title:
"Combined molecular phylogenetic analysis of the Orthoptera (Arthropoda, Insecta) and implications for their higher systematics.".

This study was previously identified under the legacy study ID S431
(Status: Published).
Matrices
Title: 16S
Description: Legacy TreeBASE Matrix ID = M634
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Acheta domesticus |
(none)
|
TGTCTTCTTGTTTTGATTTGAAGTCGTGCC |
Gryllus campestris |
(none)
|
TGTCTTCTTGAATTAATATGAAGTCGTGCC |
Gromphodorhina portentosa |
(none)
|
CTCTTCTTGTATTATTTATGAAGTATGGCC |
Grylloblatta rothi |
(none)
|
GTCTTCTTGTCTATATATGAAAGTCTGGTC |
Phyllium bioculatum |
(none)
|
??????????????????????????AACC |
Agathemera crassa |
(none)
|
?????????????????????????????? |
Ceuthophilus carlsbadensis |
(none)
|
TGTCTTTTTGAAAATAATATAAAGTCTGGC |
Comicus campestris |
(none)
|
TGTCTTTAAGATTAAAATTTAAAGTCTGGC |
Hemideina crassidens |
(none)
|
?????????????????GTGTAAAGTCGGC |
Cyphoderris monstrosus |
(none)
|
??????????????????????GTCTGGCC |
Ruspolia nitidula |
(none)
|
TGTCTTTTTGAAACTTATTTAAAGTCGGCC |
Tettigonia viridissima |
(none)
|
?????????????????????????????? |
Cylindraustralia kochii |
(none)
|
?????????????????????????????? |
Neotridactylus australis |
(none)
|
????????????????????????????AA |
Paratettix cucullatus |
(none)
|
?CTCTTTTAGTTTTTATTGAAAGTCGGGCC |
Batrachideidae sp. |
(none)
|
?????????????????????????????? |
Homeomastax dentata |
(none)
|
???????????????????AAAGTCTGGCC |
Euschmidtia cruciformis |
(none)
|
ACATGTCTTTATGTATATATAAGTCTTACC |
Prosarthria teretrirostris |
(none)
|
?CTTTTTGAAATATAATTTAAAGTCTAACC |
Stiphra robusta |
(none)
|
??????????????????????????GACT |
Systella sp. |
(none)
|
TTTTAGATTGAAATAATTCTAAGTCGTGCC |
Systella rafflesi |
(none)
|
CTTTTAGATATAATAATTAAAGGTCGTGCC |
Pneumora inanis |
(none)
|
????????????????????AAGTCTTCCC |
Bullacris membracioides |
(none)
|
?????????????????????????TGCCC |
Physemacris variolosa |
(none)
|
GTTTTTTAGATTATAATTTGAAGTCTGCCC |
Xyronotus aztecus |
(none)
|
GTCTTTTTGATAATAATTTAAAGTCTGACC |
Tanaocerus koebeli |
(none)
|
GTCTTTTTAATTATAATATGAAGTCTGGCC |
Pyrgomorpha conica |
(none)
|
TGTCTTTTTGAATAAAATTTAAAGTCTGAC |
Prosphena scudderi |
(none)
|
?????????????????????GGTCTAACC |
Batrachotetrix sp. |
(none)
|
ATGGCTTTTGATTATAATTTAAGTCTGGCC |
Glauia terrea |
(none)
|
???????????????????AAGGTCTGACC |
Rhainopomma montanum |
(none)
|
??????????TGAAAATTTAAGGTCAGACC |
Oedipoda coerulescens |
(none)
|
??????????????????????GTCTGGCC |
Gomphocerippus rufus |
(none)
|
???CTCTTGATAATATTTTGAAGTCTGGCC |
Acrida turrita |
(none)
|
??????????????????????????GGCC |
Columns
None of the columns has a description.