@ARTICLE{TreeBASE2Ref15328,
author = {Ursula Eberhardt and Franz Oberwinkler and Annemieke Verbeken and Andrea C. Rinaldi and Giovanni Pacioni and Ornella Comandini},
title = {Lactarius ectomycorrhizae on silver fir (Abies alba): morphological description, molecular charcterization, and taxonomic remarks.},
year = {2000},
keywords = {ectomycorrhizal fungi; ITS sequences; RFLP},
doi = {},
url = {http://www.jstor.org/stable/3761582},
pmid = {},
journal = {Mycologia},
volume = {92},
number = {},
pages = {830--873},
abstract = {To date, the ectomycorrhizae formed by silver fir (Abies alba), an ecologically valuable and indigenous tree species in many European mountain forests, have been poorly investigated. We characterized the mycorrhizae formed by three Lactarius species (Lac. subsericatus, Lac. intermedius, Lac. salmonicolor) on silver fir, on the basis of material originating from central Italy. The identification of the fungal symbiont was achieved by means of morphoanatomical observations of mycorrhizae, and by comparison of ITS sequences obtained from mycorrhizae and sporocarps of putative fungal partners. Sequences also were obtained from specimens of the same species but from different geographic origin or from closely related Lactarius species. A Maximum Likelihood analysis of the data was performed. On the whole, the resultant tree is in good agreement with sporocarp and mycorrhiza morphology. RFLP patterns were calculated from sequence data. A discussion on the main morphoanatomical characters distinguishing the Lactarius ectomycorrhizae reported in this study from those already described belonging to related species, is also included. The levels of resolution provided by different methods for identifying mycorrhizae, applied to such closely related taxa, are discussed.}
}
Matrix 2686 of Study 691

Citation title:
"Lactarius ectomycorrhizae on silver fir (Abies alba): morphological description, molecular charcterization, and taxonomic remarks.".

This study was previously identified under the legacy study ID S479
(Status: Published).
Matrices
Title: ITS rDNA
Description: Legacy TreeBASE Matrix ID = M702
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Lactarius fulvissimus |
(none)
|
------------------------------ |
Lactarius cf. fulvissimus |
(none)
|
------------------------------ |
Lactarius subsericatus S3 |
(none)
|
TAGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius subsericatus S2 |
(none)
|
------------------------------ |
Lactarius subsericatus ECM |
(none)
|
------AAGTAAAAGTCGTAACAAGGTTTC |
Lactarius subsericatus S1 |
(none)
|
--GAGGAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius scrobiculatus S2 |
(none)
|
-AGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius scrobiculatus S1 |
(none)
|
------------------------------ |
Lactarius intermedius ECM |
(none)
|
------------------------------ |
Lactarius intermedius S |
(none)
|
-----------AAAGTCGTAACAAGGTTTC |
Lactarius quieticolor |
(none)
|
-------------AGTCGTACCAAGGTTTC |
Lactarius semisanguifluus |
(none)
|
-AGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius deliciosus u80999 |
(none)
|
------------------------------ |
Lactarius deterrimus S2 |
(none)
|
-----GAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius deterrimus S1 |
(none)
|
----------------------------TC |
Lactarius salmonicolor S3 |
(none)
|
TAGAGGAAGTAAAAGTCGTAACAAGGTTTC |
Lactarius salmonicolor S2 |
(none)
|
-------AGTAAAAGTCGTAACAAGGTTTC |
Lactarius salmonicolor ECM |
(none)
|
---------------------CAAGGTTTC |
Lactarius salmonicolor S1 |
(none)
|
-------AGTAAAAGTCGTAACAAGGTTTC |
Columns
None of the columns has a description.