@ARTICLE{TreeBASE2Ref18174,
author = {Martin F. Wojciechowski and Michael J. Sanderson and J-M Hu},
title = {Evidence on the Monophyly of Astragalus (Fabaceae) and its Major Subgroups Based on Nuclear Ribosomal DNA ITS and Chloroplast DNA trnL Intron Data.},
year = {1999},
keywords = {},
doi = {},
url = {http://www.jstor.org/stable/2419698},
pmid = {},
journal = {Systematic Botany},
volume = {24},
number = {},
pages = {409--437},
abstract = {Phylogenetic relationships among 115 species representing the legume genus Astragalus and 12 related genera were inferred from an analysis of nucleotide sequence variation in the internal transcribed spacers and 5.8S gene of nuclear ribosomal DNA. For a subset of these taxa, the ITS data were supplemented by sequences from the chloroplast trnL intron. Phylogenies derived from maximum parsimony and neighbor-joining analyses of sequence and insertion/deletion characters all suggest that the vast majority of Astragalus is monophyletic (with the exception of ?outlier? species). All New World Astragalus species with aneuploid chromosome numbers (n = 11?15) form a monophyletic group (?Neo-Astragalus?), which now includes the Mediterranean aneuploid Astragalus echinatus. Other Old World aneuploid species are not closely related to Neo-Astragalus, but rather are found among Old World euploid (n = 8, 16) groups. Similarly, the relatively few North American species with euploid numbers are not the closest relatives to Neo-Astragalus but are dispersed among divergent Old World groups that include both aneuploid and euploid species. The historically allied genus Oxytropis is not nested within Astragalus, but forms a separate clade within the larger ?Astragalean? clade. The proposed segregate genera Astracantha (Eurasian) and Orophaca (North American) are clearly nested within Astragalus s. str. South American species of Astragalus are nested within Neo-Astragalus and comprise at least two independently derived clades (along with their close North American relatives), as previously suggested by morphology. Parsimony reconstructions of characters that have been used in the traditional subgeneric taxonomy of the genus were examined and show high levels of homoplasy. Preliminary estimates of the absolute rate of species diversification in Astragalus suggest it may be higher than in some other, often cited, continental or insular adaptive radiations in angiosperms.}
}
Matrix 2831 of Study 697

Citation title:
"Evidence on the Monophyly of Astragalus (Fabaceae) and its Major Subgroups Based on Nuclear Ribosomal DNA ITS and Chloroplast DNA trnL Intron Data.".

This study was previously identified under the legacy study ID S537
(Status: Published).
Matrices
Title: trnL
Description: Legacy TreeBASE Matrix ID = M788
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Carmichaelia williamsii |
(none)
|
????????????CCTTGGTATGGAAACTTA |
| Swainsona pterostylis |
(none)
|
????????????CCTTGGTATGGAAACTTA |
| Clianthus puniceus |
(none)
|
??????????????TTGGTATGGAAACTTA |
| Lessertia herbacea |
(none)
|
??????????????TTGGTATGGAAACTTA |
| Sphaerophysa salsula |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Biserrula pelecinus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Sutherlandia frutescens |
(none)
|
????????????CCTTGGTATGGAAACTTA |
| Colutea arborescens |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Oxytropis besseyi |
(none)
|
???????????GCCTTGGTATGGAAACTTA |
| Oxytropis lambertii |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus sinicus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus asterias |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus peristereus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus atropilosulus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus boeticus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus echinatus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus alpinus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus umbellatus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus eucosmus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus robbinsii |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus australis |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus canadensis |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus adsurgens |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus pehuenches |
(none)
|
?ATTGGAT-GAGCCTTGGTATGGAAACT?A |
| Astragalus palenae var. palenae |
(none)
|
AATTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus nothoxys |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus linifolius |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus bodinii |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus gilviflorus |
(none)
|
??TTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus douglasii |
(none)
|
TATTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus arizonicus |
(none)
|
AATTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus collinus |
(none)
|
AATTGGATTGAGCCTTGGTATGGAAACTTA |
| Astragalus sabulonum |
(none)
|
AATTGGATTGAGCCTTGGTATGGAAACTTA |
| Caragana arborescens |
(none)
|
??????????AGCCTTGGTATGGAAACTTA |
Columns
None of the columns has a description.