@ARTICLE{TreeBASE2Ref16090,
author = {Martyn Kennedy and Russell D. Gray and Hamish G. Spencer},
title = {The phylogenetic relationships of the shags and cormorants: Can sequence data resolve a disagreement between behaviour and morphology?},
year = {2000},
keywords = {},
doi = {10.1006/mpev.2000.0840},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {17},
number = {},
pages = {345--359},
abstract = {Taxonomic arrangements for the cormorants and shags (Phalacrocoracidae) had varied greatly until two quite similar arrangements, one based on behavior and the other on osteological characters, became the basis for current thought on the evolutionary relationships of these birds. The terms cormorant and shag, which had previously been haphazardly applied to members of the group, became the vernacular terms for the two major subdivisions within this family. The two taxonomies differ in places, however, with the behavioral taxonomy placing several species within the shags and the osteological taxonomy and phylogeny grouping those species (as the marine cormorants) and placing them within the cormorants. In an attempt to resolve the differences in the relationships hypothesized by behavior and morphology, we sequenced three mitochondrial genes (12S, ATPase 6, and ATPase 8). Initial equally weighted parsimony trees differed slightly from our two weighted parsimony trees, one of which was also our maximum-likelihood tree. Many of the branches within our trees were well supported, but some sections of the phylogeny proved difficult to resolve with confidence. Our sequence trees differ substantially from the morphological phylogeny and show that neither the shags nor the cormorants are monophyletic, but form an intermingled group. Some of the groups supported by both the behavioral and the morphological taxonomies (e.g., the cliff shags, Stictocarbo) appear to be polyphyletic. Conversely, the monophyly of the blue-eyed shags, a traditional group that the osteological analysis had found to be paraphyletic, was supported by the sequence data. Until more taxa are sampled and a fully robust phylogeny is obtained, a conservative approach accepting a single genus, Phalacrocorax, for the shags and cormorants is recommended.}
}
Matrix 2295 of Study 724

Citation title:
"The phylogenetic relationships of the shags and cormorants: Can sequence data resolve a disagreement between behaviour and morphology?".

This study was previously identified under the legacy study ID S568
(Status: Published).
Matrices
Title: ATPase 8, ATPase 6, and 12S
Description: Legacy TreeBASE Matrix ID = M861
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Phalacrocorax chalconotus |
(none)
|
??TATCCTA{CT}TAACCTCATGACTAACA |
Phalacrocorax punctatus |
(none)
|
TTCATCCTACTAACCTCATGACTAACATTC |
Phalacrocorax albiventer |
(none)
|
TTTATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax gaimardi |
(none)
|
?????????????????????????????? |
Phalacrocorax urile |
(none)
|
TTTATCTTACTAACCTCATGACTAACATTT |
Phalacrocorax featherstoni |
(none)
|
??????????????????????????ATTC |
Phalacrocorax varius |
(none)
|
TTCATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax pelagicus |
(none)
|
TTTATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax brasilianus |
(none)
|
TTCATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax magellanicus |
(none)
|
TTTATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax purpurascens |
(none)
|
???????????????????GACTAACATTT |
Phalacrocorax melanoleucos |
(none)
|
???????????????????????AACATTC |
Phalacrocorax sulcirostris |
(none)
|
TTCATCCTACTA?CCTCATGACTAACATTT |
Phalacrocorax capillatus |
(none)
|
?????????????????????????????? |
Phalacrocorax bougainvillii |
(none)
|
?????????????????????????????? |
Phalacrocorax aristotelis |
(none)
|
TTTATCATACTGATCTCATGACTAACATTT |
Phalacrocorax auritus |
(none)
|
TTCATCCTACTAGCCTCATGACTAACATTT |
Phalacrocorax onslowi |
(none)
|
?????CCTACTAACCTCATGACTAA{CT}A |
Phalacrocorax capensis |
(none)
|
?????????????????????????????? |
Phalacrocorax campbelli |
(none)
|
TTTATCCTACTAACCTCATGACTAACATTT |
Phalacrocorax penicillatus |
(none)
|
???ATCTTACTAACCTCATGACTAACATTT |
Phalacrocorax carbo |
(none)
|
TTCATCCTACTAGCCTCATGACTAACATTC |
Sula sula |
(none)
|
?TCATCCTAACCCTATCATGACTAAC{AC} |
Morus serrator |
(none)
|
CTCATCTTATTAATATCATGACTAACATTC |
Columns
None of the columns has a description.