@ARTICLE{TreeBASE2Ref15150,
author = {Robert H. Cruickshank and Kevin P. Johnson and Vincent S. Smith and Richard J. Adams and Dale H. Clayton and Roderic D. M. Page},
title = {Phylogenetic analysis of partial sequences of elongation factor 1 alpha identifies major groups of lice (Insecta: Phthiraptera).},
year = {2001},
keywords = {elongation factor 1?; leaf stability analysis; molecular systematics; niche specialization; phylogenetics; lice; Phthiraptera; Ischnocera},
doi = {10.1006/mpev.2001.0928},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {19},
number = {2},
pages = {202--215},
abstract = {As a first attempt to use molecular data to resolve the relationships between the four suborders of lice and within the suborder Ischnocera, we sequenced a 347bp fragment of the elongation factor 1 alpha gene of 127 lice (Insecta: Phthiraptera) as well as outgroup taxa from the order Psocoptera. Phylogenetic analysis of these sequences revealed a number of well-supported monophyletic groups, but the relationships between many of these groups could not be resolved. While it is probable that multiple substitutions at high divergences and ancient radiation over a short period of time have contributed to the problem, we attribute most of this lack of resolution to the high ratio of taxa to characters. Nevertheless, the sequence data unequivocally support a number of important relationships that are at variance with the conclusions of morphological taxonomy. These include the sister group relationship of Chelopistes and Oxylipeurus, two genera of lice occupying different ecological niches on the same host, which have previously been assigned to different families. These results provide evidence that lice have speciated in situ on the host in response to niche specialisation, and that this has given rise to convergent morphologies in the lice of different host groups which share similar ecological niches. We discuss our attempts to overcome the limitations of this large data set, including the use of leaf stability analysis, a new method for analysing the stability of taxa in a phylogenetic tree, and examine a number of hypotheses of relationships based on both traditional taxonomy and host associations.}
}
Matrix 12559 of Study 726

Citation title:
"Phylogenetic analysis of partial sequences of elongation factor 1 alpha identifies major groups of lice (Insecta: Phthiraptera).".

This study was previously identified under the legacy study ID S570
(Status: Published).
Matrices
Title: TN28
Description: TN28 loci
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Teratosphaeria nubilosa CMW 3282 ex-epitype Victoria(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 26014 South Africa(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 26218 Uruguay(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30900 Brazil(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30714 NSW(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30752 Victoria(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30751 Victoria(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30715 NSW(Group C) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30707 NSW(Group A) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30709 NSW(Group A) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30717 NSW(Group A) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30735 Tasmania(Group B) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30723 WA(Group B) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30745 Victoria(Group B) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 30750 Vicoria(Group B) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
| Teratosphaeria nubilosa CMW 31008 New Zealand(Group B) |
(none)
|
ATTCCGGAGGGCATGCCTGTTCGAGCGTCA |
Columns
None of the columns has a description.