@ARTICLE{TreeBASE2Ref16850,
author = {Karsten Nielsen and David Simon Yohalem},
title = {Origin of a polyploid Botrytis pathogen through interspecific hybridization between Botrytis aclada and B. byssoidea.},
year = {2001},
keywords = {Botryotinia; Botrytis cinerea; Botrytis squamosa; fungal hybrid species; speciation},
doi = {},
url = {http://www.jstor.org/stable/3761668},
pmid = {},
journal = {Mycologia},
volume = {93},
number = {6},
pages = {1064--1071},
abstract = {Botrytis aclada has previously been divided into two subgroups (AI and AII) based on spore size, chromosome number and genetic markers. A recent study of genetic diversity using universal-primed PCR (UP-PCR) fingerprints showed that subgroup AII of B. aclada was a possible hybrid species between B. byssoidea and subgroup AI of B. aclada. To test this hypothesis, we sequenced a UP-PCR fragment (?550 bp) from representative isolates of four Botrytis species, all causing disease on onions. A mixture of two nucleotides at each nucleotide position was found in all AII isolates analyzed at 23 positions in the sequence. These isolates had 32 chromosomes, whereas all AI isolates had 16 chromosomes. Pair-wise comparison of the sequences of the four Botrytis species showed that a hybridization event between B. aclada (AI) and B. byssoidea could explain all 23 positions with mixed nucleotides, supporting them as being parental ancestors to AII. These results indicate that at least one Botrytis pathogen has evolved through interspecific hybridization.}
}
Matrix 800 of Study 764

Citation title:
"Origin of a polyploid Botrytis pathogen through interspecific hybridization between Botrytis aclada and B. byssoidea.".

This study was previously identified under the legacy study ID S617
(Status: Published).
Matrices
Title: UP-PCR fragment
Description: Legacy TreeBASE Matrix ID = M952
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Botrytis cinerea BC3 |
(none)
|
GAAGCTTTGGAGTCAAAGCTGGTCCCAGAC |
Botrytis squamosa BS2 |
(none)
|
GGATCTTTGGTGTCAAAGCTGGTCCCAAAC |
Botrytis squamosa BS11 |
(none)
|
GGATCTTTGGTGTCAAAGCTGGTCCCAAAC |
Botrytis squamosa BS6 |
(none)
|
GGATCTTTGGTGTCAAAGCTGGTCCCAAAC |
Botrytis byssoidea BB1 |
(none)
|
GGAGCTTTGGTGTCAAAGCTGGCCCCAAAC |
Botrytis byssoidea BB5 |
(none)
|
GGAGCTTTGGTGTCAAAGCTGGCCCCAAAC |
Botrytis byssoidea BB6 |
(none)
|
GGAGCTTTGGTGTCAAAGCTGGCCCCAAAC |
Botrytis aclada SAL003 |
(none)
|
GAAGTTTTGGTGTCAAAGCTGGTCCCAGAC |
Botrytis aclada SAL006 |
(none)
|
GAAGTTTTGGTGTCAAAGCTGGTCCCAGAC |
Botrytis aclada SAL005 |
(none)
|
GAAGTTTTGGTGTCAAAGCTGGTCCCAGAC |
Botrytis aclada BA8 |
(none)
|
GAAGTTTTGGTGTCAAAGCTGGTCCCAGAC |
Columns
None of the columns has a description.