@ARTICLE{TreeBASE2Ref16936,
author = {Mark E Olson},
title = {Intergeneric relationships within the Caricaceae-Moringaceae clade (Brassicales), and potential morphological synapomorphies of the clade and its families.},
year = {2002},
keywords = {Brassicales; Caricaceae; Moringaceae; phylogeny; morphology},
doi = {10.1086/324046},
url = {},
pmid = {},
journal = {International Journal of Plant Sciences},
volume = {163},
number = {1},
pages = {51?65},
abstract = {Recently published molecular phylogenetic studies indicate a sister taxon relationship between Caricaceae and Moringaceae; such a relationship was not identified in nearly 250 yr of morphological studies because the families share few obvious similarities. This study tests the monophyly of both families and attempts to identify morphological synapomorphies of the two?family clade and of each family. Parsimony analysis of DNA sequence variation in the chloroplast gene rbcL supports the monophyly of both families. Sampling includes six original rbcL sequences and 20 from the GenBank database, with single representatives of each of the four genera of Caricaceae and four members of the monogeneric Moringaceae. To reconstruct intergeneric relationships, one nuclear (ITS) and one chloroplast (trnG) locus were sequenced from one to two members of each of the four genera of Caricaceae, with two species of Moringa used as an outgroup. In the tree resulting from the combined analysis of the ITS and trnG data sets, Cylicomorpha is the sister taxon to the rest of Caricaceae, which comprises Jarilla as the sister taxon to a Carica?Jacaratia clade. To identify synapomorphies, morphological characters with state distributions congruent with the clades of interest are assessed for their similarity in structure, location, and function. Synapomorphies of the Caricaceae?Moringaceae clade include subulate glands at the base and apex of the petiole and on the lamina and the pachycaul ?bottle tree? life form. Synapomorphies of Caricaceae include articulated laticifers and the absence of libriform fibers. Synapomorphies of Moringaceae include pinnately compound leaves and monothecal, bisporangiate anthers.}
}
Matrix 208 of Study 801

Citation title:
"Intergeneric relationships within the Caricaceae-Moringaceae clade (Brassicales), and potential morphological synapomorphies of the clade and its families.".

This study was previously identified under the legacy study ID S658
(Status: Published).
Matrices
Title: trn G
Description: Legacy TreeBASE Matrix ID = M1032
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Jarilla chocola AF378624 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATA- |
Jarilla heterophylla AF378625 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATA- |
Jacaratia corumbensis AF378622 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATA- |
Carica microcarpa AF378623 |
(none)
|
--AATGGGCGATGTTACGCTAATAATATA- |
Cylicomorpha AF378626 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATA- |
Cylicomorpha AF378627 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATA- |
Moringa longituba AF378643 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATAT |
Moringa drouhardii AF378628 |
(none)
|
GATATGGGCGATGTTACGCTAATAACATAT |
Columns
None of the columns has a description.