CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 269 of Study 833

About Citation title: "A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea.".
About This study was previously identified under the legacy study ID S691 (Status: Published).

Matrices

Title: Figs. 3 and 4

Description: Legacy TreeBASE Matrix ID = M1098

Rows

Taxon Label Row Segments Characters 1–30
Magnaporthe rhizophila 96043  (none) CGGTGATGATGCTCCCCGTGCCGTCTTCCG
Magnaporthe poae  (none) CGGTGATGATGCTCCCCGTGCCGTCTTCCG
Magnaporthe rhizophila 58114  (none) CGGTGATGATGCTCCCCGTGCCGTCTTCCG
Magnaporthe salvinii frm Oryza sativa MS-1  (none) CGGTGATGATGCTCCCCGTGCTGTCTTCCG
Magnaporthe grisea frm Digitaria smutsii JP34  (none) CGGTGATGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Digitaria sp. 91T16  (none) CGGTGATGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Digitaria horizontalis Py-D  (none) CGGTGATGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Digitaria sp. 81T4  (none) CGGTGATGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm lab strain FGSC 8465  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm lab strain FGSC 8470  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Setaria sp. 1152  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa A119  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa A598  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eragrostis curvula K76-79  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa Guy11  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa R694-2b  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa ML-91  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eragrostis curvula NI909  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa BK-6  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa A347  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Lolium perenne 365  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eleusine indica C10  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eleusine coracana RW12  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa R707-1E  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa ML-56  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Setaria sp. G48  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa BK-19  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Oryza sativa A264  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Lolium perenne 330  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eleusine indica T28  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG
Magnaporthe grisea frm Eleusine coracana 1122  (none) CGGTGACGATGCTCCCCGCGCCGTCTTCCG

Columns

None of the columns has a description.