@ARTICLE{TreeBASE2Ref16486,
author = {Barbara L. Lundrigan and Sharon A. Jansa and Priscilla K. Tucker},
title = {Phylogenetic relationships in the genus Mus, based on paternally, maternally, and biparentally inherited characters.},
year = {2002},
keywords = {Coelomys; molecular phylogeny; Muridae; Mus; Nannomys; Pyromys},
doi = {10.1080/10635150290069878},
url = {},
pmid = {},
journal = {Systematic Biology},
volume = {51},
number = {3},
pages = {410--431},
abstract = {Several species in the rodent genus Mus are used as model research organisms, but comparative studies of these mice have been hampered by the lack of a well-supported phylogeny. We used DNA sequences from six genes representing paternally, maternally, and biparentally inherited regions of the genome to infer phylogenetic relationships among 10 species of Mus commonly used in laboratory research. Our sample included seven species from the subgenus Mus; one species each from the subgenera Pyromys, Coelomys, and Nannomys; and representatives from three additional murine genera, which served as outgroups in the phylogenetic analyses. Although each of the six genes yielded a unique phylogeny, several clades were supported by four or more gene trees. Nodes that conflicted between trees were generally characterized by weak support for one or both of the alternative topologies, thus providing no compelling evidence that any individual gene, or part of the genome, was misleading with respect to the evolutionary history of these mice. Analysis of the combined data resulted in a fully resolved tree that strongly supports monophyly of the genus Mus, monophyly of the subgenus Mus, division of the subgenus Mus into Palearctic (M. musculus, M. macedonicus, M. spicilegus, and M. spretus) and Asian (M. cervicolor, M. cookii, and M. caroli) clades, monophyly of the house mice (M. m. musculus, "M. m. molossinus," M. m. castaneus, and M. m. domesticus), and a sister-group relationship between M. macedonicus and M. spicilegus. Other clades that were strongly supported by one or more gene partitions were not strongly supported by the combined data. This appears to reflect a localized homoplasy in one partition obscuring the phylogenetic signal from another, rather than differences in gene or genome histories.}
}
Matrix 288 of Study 841

Citation title:
"Phylogenetic relationships in the genus Mus, based on paternally, maternally, and biparentally inherited characters.".

This study was previously identified under the legacy study ID S700
(Status: Published).
Matrices
Title: Six genes
Description: Legacy TreeBASE Matrix ID = M1118
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Rattus |
(none)
|
AGCCCTACAGCCTCAGGACATATTAATCTC |
| Mastomys |
(none)
|
AGCCCTACAGCCACAGGATATCTCAAGCTC |
| Hylomyscus |
(none)
|
AGCCCTACAGCCACAGGATATCTTAAGCTC |
| Mus minutoides |
(none)
|
AGCCCTACAGCCACATGATATCTTAAGCTC |
| Mus saxicola |
(none)
|
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN |
| Mus pahari |
(none)
|
AGCCCTACAGCCACATGATATCTTAAGCTC |
| Mus cookii |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus caroli |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus cervicolor |
(none)
|
AGCCCTACAGCCACATGATGTCCTAAACTC |
| Mus spretus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus spicilegus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus macedonicus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus musculus domesticus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus musculus molossinus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus musculus castaneus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
| Mus musculus musculus |
(none)
|
AGCCCTACAGCCACATGATATCTTAAACTC |
Columns
None of the columns has a description.