@ARTICLE{TreeBASE2Ref14976,
author = {Priscila Chaverri and Gary J. Samuels and Elwin L. Stewart},
title = {Hypocrea virens sp. nov., the teleomorph of Trichoderma virens.},
year = {2000},
keywords = {Ascomycetes; biological control; Hypocreales; systematics; teleomorph-anamorph connection },
doi = {},
url = {http://www.jstor.org/stable/3761672},
pmid = {},
journal = {Mycologia},
volume = {93},
number = {6},
pages = {1113--1124},
abstract = {The new species Hypocrea virens, has been found to be the teleomorph of Trichoderma virens, a species commonly used in biological control applications. This conclusion is based on the comparison of morphological and molecular data from four isolates of T. virens and a single collection and isolate of H. virens. Data for several morphological characters, including colony and growth characteristics, were collected. In addition, sequence data from ITS1, 5.8S, ITS2 rDNA and translation elongation factor (tef-1?) were analyzed for the five isolates. Analysis of phenotypic characters show that cultures and microscopic characters of the anamorph of H. virens are indistinguishable from those of T. virens. This is consistent with sequence data from ITS1, 5.8S, ITS2 rDNA which show that the sequence of H. virens is identical to that of the ex-type isolate of T. virens. Despite minor in tef-1? sequences, T. virens isolates and H. virens form a monophyletic group that is different from other examined species of Hypocrea; this clade is supported by a 100% bootstrap value. Molecular and morphological data confirm the connection between H. virens and T. virens.}
}
Matrix 311 of Study 857

Citation title:
"Hypocrea virens sp. nov., the teleomorph of Trichoderma virens.".

This study was previously identified under the legacy study ID S719
(Status: Published).
Matrices
Title: ITS tef-1
Description: Legacy TreeBASE Matrix ID = M1145
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Hypocrea nigricans GJS98.183 |
(none)
|
----------------------CCCTCCGT |
| Hypocrea flavovirens PC4 |
(none)
|
----------------------CCTCCGTA |
| Trichoderma virens GL39 |
(none)
|
TGGAAGTAAAAGTCGTAACAAGGTCTCCGT |
| Trichoderma virens GL21 |
(none)
|
---------------------GGTCTCCGT |
| Trichoderma virens GL20 |
(none)
|
TGGAAGTAAAAGTCGTAACAAGGTCTCCGT |
| Trichoderma virens GL3 |
(none)
|
TGGAAGTAAAAGTCGTAACAAGGTCTCCGT |
| Hypocrea virens GJS95.194 |
(none)
|
T----------------------------- |
Columns
None of the columns has a description.