@ARTICLE{TreeBASE2Ref15024,
author = {Martin P. A. Coetzee and Brenda D Wingfield and Paulette Bloomer and Geoff S. Ridley and Michael J Wingfield},
title = {Molecular identification and phylogeny of Armillaria isolates from South America and Indo-Malaysia.},
year = {2003},
keywords = {Armillaria limonea; Armillaria luteobubalina; Armillaria novae-zelandiae; IGS-1; ITS; phylogeny; systematics},
doi = {},
url = {http://www.mycologia.org/cgi/content/abstract/95/2/285},
pmid = {},
journal = {Mycologia},
volume = {95},
number = {2},
pages = {285--293},
abstract = {Armillaria root rot is a serious disease, chiefly of woody plants, caused by many species of Armillaria that occur in temperate, tropical and subtropical regions of the world. Very little is known about Armillaria in South America and Southeast Asia, although Armillaria root rot is well known in these areas. In this study, we consider previously unidentified isolates collected from trees with symptoms of Armillaria root rot in Chile, Indonesia and Malaysia. In addition, isolates from basidiocarps resembling A. novae-zelandiae and A. limonea, originating from Chile and Argentina, respectively, were included in this study because their true identity has been uncertain. All isolates in this study were compared, based on their similarity in ITS sequences with previously sequenced Armillaria species, and their phylogenetic relationship with species from the Southern Hemisphere was considered. ITS sequence data for Armillaria also were compared with those available at GenBank. Parsimony and distance analyses were conducted to determine the phylogenetic relationships between the unknown isolates and the species that showed high ITS sequence similarity. In addition, IGS-1 sequence data were obtained for some of the species to validate the trees obtained from the ITS data set. Results of this study showed that the ITS sequences of the isolates obtained from basidiocarps resembling A. novae-zelandiae are most similar to those for this species. ITS sequences for isolates from Indonesia and Malaysia had the highest similarity to A. novae-zelandiae but were phylogenetically separated from this species. Isolates from Chile, for which basidiocarps were not found, were similar in their ITS and IGS-1 sequences to the isolate from Argentina that resembled A. limonea. These isolates, however, had the highest ITS and IGS-1 sequence similarity to authentic isolates of A. luteobubalina and were phylogenetically more closely related to this species than to A. limonea.}
}
Matrix 375 of Study 899

Citation title:
"Molecular identification and phylogeny of Armillaria isolates from South America and Indo-Malaysia.".

This study was previously identified under the legacy study ID S771
(Status: Published).
Matrices
Title: IGS
Description: Legacy TreeBASE Matrix ID = M1219
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Armillaria hinnulea CMW4990 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria hinnulea CMW4980 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria limonea CMW4991 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria limonea CMW4992 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria limonea CMW4681 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria limonea CMW4680 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria luteobubalina CMW5704 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria luteobubalina CMW4974 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria luteobubalina CMW4976 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria luteobubalina CMW4977 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria South America Isolate CMW5446 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria South America Isolate CMW8879 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria South America Isolate CMW8877 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
| Armillaria South America Isolate CMW8876 |
(none)
|
AGCCCTTGTTCTAAAGATTTGTTCAACTTT |
Columns
None of the columns has a description.