@ARTICLE{TreeBASE2Ref17624,
author = {Julian R. Starr and Stephen A. Harris and David A. Simpson},
title = {Potential of the 5' and 3' ends of the intergenic spacer (IGS) of rDNA in the Cyperaceae: new sequences for lower-level phylogenies in sedges with an example from Uncinia Pers.},
year = {2003},
keywords = {ETS; IGS; rDNA; phylogenetic utility; Cyperaceae; Juncaceae},
doi = {10.1086/346168},
url = {},
pmid = {},
journal = {International Journal of Plant Sciences},
volume = {164},
number = {2},
pages = {213?227},
abstract = {In plants, the internal transcribed spacers (ITS; ca. 450 base pairs) of nuclear ribosomal DNA (rDNA) are the only well?characterized nuclear sequences that are both easily amplified and appropriately variable for addressing relationships at lower taxonomic levels. In this study, we assess the utility of rDNA noncoding fragments from the external transcribed spacer 1 (ETS 1f) and from the 5? end of the intergenic spacer (5' IGSf) for reconstructing lower?level relationships in the Cyperaceae. Phylogenetic analyses using the genus Uncinia (tribe Cariceae) as a model indicate that phylogenies inferred from ETS 1f and 5' IGSf sequences are congruent with those derived from ITS. Although ITS and ETS 1f sequences evolve at similar rates, 5' IGSf sequences evolve ca. 1.3 times faster. The combined analysis of all three regions (ca. 1414 bp) produced 3.6 times more informative characters than ITS and greater than 40 times more than trnT?L and trnL?F spacer data. Trees derived from combined analyses were the most robust and resolved. Infraspecific variation in the ETS 1f (0.0%?0.17%) and 5' IGSf (0.0%) was extremely low, indicating that variation within species will not be a problem for phylogenetic analysis. Amplification experiments indicate that ETS 1f primers are universal for the Cyperaceae (ca. 5000 spp.) and Juncaceae (ca. 300 spp.), while 5' IGSf primers are limited to tribe Cariceae (ca. 2300 spp.). Phylogenetic analyses suggest that sections Uncinia and Platyandrae are monophyletic but that series circumscriptions are largely artificial. A significant topological difference with key taxonomic and biogeographical implications between ITS and combined analyses stresses the importance of using all three noncoding regions to infer lower?level phylogenies.}
}
Matrix 417 of Study 926

Citation title:
"Potential of the 5' and 3' ends of the intergenic spacer (IGS) of rDNA in the Cyperaceae: new sequences for lower-level phylogenies in sedges with an example from Uncinia Pers.".

This study was previously identified under the legacy study ID S803
(Status: Published).
Matrices
Title: ITS_ETS1f_5'IGSf rDNA
Description: Legacy TreeBASE Matrix ID = M1269
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Uncinia lacustris |
(none)
|
TCGTCGCCCCTCGAAAAACACGACCGTTGC |
| Uncinia phleoides |
(none)
|
TCGTCGCCCCTCGAAAAACACGACCGTTGC |
| Uncinia multifaria |
(none)
|
TCGTCGCCCCTCGAAAAACACGACCGTTGC |
| Uncinia hamata |
(none)
|
CCGTTGCCCCTCGAAAAACACGACCGTTGC |
| Uncinia ecuadorensis |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTTGC |
| Uncinia tenuis 2 |
(none)
|
CCGTTGCC-TTCGAAAAACACGACCGTTGC |
| Uncinia tenuis 1 |
(none)
|
CCGCTGCC-TTCGAAAAACACGACCGTTGC |
| Uncinia subsacculata |
(none)
|
CCGTTGCCCTTCGAAAGACACGACCGTTGC |
| Uncinia ferruginea |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTTGC |
| Uncinia clavata |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTTGC |
| Uncinia flaccida |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGCTGC |
| Uncinia rupestris |
(none)
|
TCGTCGCCTCTCGAAAAACACGACCGTCGC |
| Uncinia banksii 2 |
(none)
|
TCGTTGCCCCTCGAAAAACACGACCGTTGC |
| Uncinia banksii 1 |
(none)
|
TCGTTGCCCCTCGAAAAACACGACCGTCGC |
| Uncinia leptostachya |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTCGC |
| Uncinia rubra |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTCGC |
| Uncinia scabra |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTCGC |
| Uncinia laxiflora |
(none)
|
TCGTTGCCTCTCGAAAAACACGACCGTCGC |
| Carex vallis pulchrae |
(none)
|
TCGTTGCCTTTCCAAAAACACGACCGTTGC |
Columns
None of the columns has a description.