@ARTICLE{TreeBASE2Ref23135,
author = {Alberto Vicens and Maximiliano Tourmente and Eduardo RS Roldan},
title = {Structural evolution of CatSper1 in rodents is influenced by sperm competition, with effects on sperm swimming velocity },
year = {2014},
keywords = {CatSper1, sperm competition, indels, positive selection, sperm velocity, rodents.},
doi = {},
url = {http://www.biomedcentral.com/author/manuscript/details/view.do?txt_nav=man&txt_man_id=9053079911872469&manuscriptId=9053079911872469 },
pmid = {},
journal = {BMC EVolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: Competition between spermatozoa from rival males for success in fertilization (i.e., sperm competition) is an important selective force driving the evolution of male reproductive traits and promoting positive selection in genes related to reproductive function. Positive selection has been identified in reproductive proteins showing rapid divergence at nucleotide level. Other mutations, such as insertions and deletions (indels), also occur in protein-coding sequences. These structural changes, which exist in reproductive genes and result in length variation in coded proteins, could also be subjected to positive selection and be under the influence of sperm competition. Catsper1 is one such reproductive gene coding for a germ-line specific voltage-gated calcium channel essential for sperm motility and fertilization. Positive selection appears to promote fixation of indels in the N-terminal region of CatSper1 in mammalian species. However, it is not known which selective forces underlie these changes and their implications for sperm function.
Results: We tested if length variation in the N-terminal region of CatSper1 is influenced by sperm competition intensity in a group of closely related rodent species of the subfamily Murinae. Our results revealed a negative correlation between sequence length of CatSper1 and relative testes mass, a very good proxy of sperm competition levels. Since CatSper1 is important for sperm flagellar motility, we examined if length variation in the N-terminus of CatSper1 is linked to changes in sperm swimming velocity. We found a negative correlation between CatSper1 length and several sperm velocity parameters.
Conclusions: Altogether, our results suggest that sperm competition selects for a shortening of the intracellular region of CatSper1 which, in turn, enhances sperm swimming velocity, an essential and adaptive trait for fertilization success.
}
}
Matrix 21940 of Study 15721

Citation title:
"Structural evolution of CatSper1 in rodents is influenced by sperm competition, with effects on sperm swimming velocity ".

Study name:
"Structural evolution of CatSper1 in rodents is influenced by sperm competition, with effects on sperm swimming velocity ".

This study is part of submission 15721
(Status: Published).
Matrices
Title: First exon of Catsper1 gene (murid species)
Description: Alignment of the first exon of Catsper1 gene (murid species)
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Mus musculus musculus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus musculus castaneus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus musculus domesticus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus musculus bactrianus |
(none)
|
ATGGATCAATCTTCGAGGAGGGACGAGTCT |
Mus macedonicus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus spicilegus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus spretus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus famulus |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus cookii |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus caroli |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus pahari |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGTCT |
Mus minutoides |
(none)
|
ATGGATCAATCTTCAAGGAGGGACGAGGCT |
Mastomys natalensis |
(none)
|
ATGGATCAACCTTCAAGGA{CT}GGGCGAG |
Apodemus sylvaticus |
(none)
|
ATGGATCAACCTTCAAGGA{CT}GGGCGAG |
Lemniscomys barbarus |
(none)
|
ATGGATCAACCTTCAAGGACAGATGAGTCT |
Rattus norvegicus |
(none)
|
ATGGATCAACCTTCAAGGACAGACGAGTCT |
Columns
None of the columns has a description.