@ARTICLE{TreeBASE2Ref20250,
author = {Antonis Krimitzas and Ioanna Pyrri and Vassili N Kouvelis and Evangelia Kapsanaki-Gotsi and Milton A Typas},
title = {A Phylogenetic Analysis of Greek Isolates of Aspergillus Species Based on Morphology and Nuclear and Mitochondrial Gene Sequences},
year = {2013},
keywords = {Aspergillus; nuclear genes; mitochondrial genes; multi-locus phylogeny; anamorphs; teleomorphs},
doi = {10.1155/2013/260395},
url = {http://www.hindawi.com/journals/bmri/2013/260395/},
pmid = {},
journal = { BioMed Research International},
volume = {2013},
number = {260395},
pages = {18},
abstract = {Aspergillus species originating from Greece were examined by morphological and molecular criteria to explore the diversity of this genus. The phylogenetic relationships of these species were determined using sequences from the ITS and IGS region of the nuclear rRNA gene complex, two nuclear genes [β-tubulin (benA) and RNA polymerase II second largest subunit (rpb2)] and two mitochondrial genes [small rRNA subunit (rns) and cytochrome oxidase subunit I (cox1)] and, where available, related sequences from databases. The morphological characters of the anamorphs and teleomorphs, and the single gene phylogenetic trees, differentiated and placed the species examined in the well-supported sections of Aenei, Aspergillus, Bispori, Candidi, Circumdati, Clavati, Cremei, Flavi, Flavipedes, Fumigati, Nidulantes, Nigri, Restricti, Terrei, Usti and Zonati, with few uncertainties. The combined use of the three commonly employed nuclear genes (benA, rpb2 and ITS), the IGS region, and two less often used mitochondrial gene sequences (rns and cox1) as a single unit, resolved several taxonomic ambiguities. A phylogenetic tree was inferred using Neighbour-Joining, Maximum Parsimony and Bayesian methods. The strains examined formed seven well-supported clades within the genus Aspergillus. Altogether, the concatenated nuclear and mitochondrial sequences offer additional tools for an improved understanding
of phylogenetic relationships within this genus.}
}
Matrix 3893 of Study 12165

Citation title:
"A Phylogenetic Analysis of Greek Isolates of Aspergillus Species Based on Morphology and Nuclear and Mitochondrial Gene Sequences".

Study name:
"A Phylogenetic Analysis of Greek Isolates of Aspergillus Species Based on Morphology and Nuclear and Mitochondrial Gene Sequences".

This study is part of submission 12165
(Status: Published).
Matrices
Title: Perissodactyla supermatrix B
Description: Legacy TreeBASE Matrix ID = M4236
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Bos taurus |
(none)
|
ATGTTCATAATTAACATCTTAATACTAATT |
| Ceratotherium simum |
(none)
|
ATGTTCACAATTAATATTCTCCTCCTAGTC |
| Dicerorhinus sumatrensis |
(none)
|
?????????????????????????????? |
| Diceros bicornis |
(none)
|
?????????????????????????????? |
| Equus asinus |
(none)
|
ATGTTCATAATTAACGTCCTCCTCTTAATT |
| Equus burchellii |
(none)
|
?????????????????????????????? |
| Equus caballus |
(none)
|
ATGTTCATAATTAACGTCCTCCTCCTAATT |
| Equus grevyi |
(none)
|
?????????????????????????????? |
| Equus hemionus |
(none)
|
?????????????????????????????? |
| Equus kiang |
(none)
|
?????????????????????????????? |
| Equus onager |
(none)
|
?????????????????????????????? |
| Equus quagga |
(none)
|
?????????????????????????????? |
| Equus zebra |
(none)
|
?????????????????????????????? |
| Rhinoceros sondaicus |
(none)
|
?????????????????????????????? |
| Rhinoceros unicornis |
(none)
|
ATGTTCACGATTAACATTCTCCTCCTAATC |
| Tapirus bairdii |
(none)
|
?????????????????????????????? |
| Tapirus indicus |
(none)
|
?????????????????????????????? |
| Tapirus pinchaque |
(none)
|
?????????????????????????????? |
| Tapirus terrestris |
(none)
|
ATGTTTATACTTAACATTATCCTTATAATT |
Columns
None of the columns has a description.