@ARTICLE{TreeBASE2Ref15698,
author = {Kenneth M. Halanych and Terence J. Robinson},
title = {The utility of cytochrome b and 12S rDNA data for phylogeny reconstruction of leporid (Lagomorpha) genera.},
year = {1999},
keywords = {Leporidae; Rabbits; Cytochrome b; 12S rRNA; Lagomorph evolution; Saturation; Phylogenetics},
doi = {10.1007/PL00006481},
url = {},
pmid = {},
journal = {Journal of Molecular Evolution},
volume = {48},
number = {},
pages = {369--379},
abstract = {Partial sequences of two mitochondrial genes, the 12S ribosomal gene (739 bp) and the cytochrome b gene (672 bp), were analyzed in hopes of reconstructing the evolutionary relationships of 11 leporid species, representative of seven genera. However, partial cytochrome b sequences were of little phylogenetic value in this study. A suite of pairwise comparisons between taxa revealed that at the intergeneric level, the cytochrome b gene is saturated at synonymous coding positions due to multiple substitution events. Furthermore, variation at the nonsynonymous positions is limited, rendering the cytochrome b gene of little phylogenetic value for assessing the relationships between leporid genera. If the cytochrome b data were analyzed without accounting for these two classes of nucleotides (i.e., synonymous and nonsynonymous sites), one may incorrectly conclude that signal exists in the cytochrome b data. The mitochondrial 12S rRNA gene, on the other hand, has not experienced excessive saturation at either stem or loop positions. Phylogenies reconstructed from the 12S rDNA data support hypotheses based on fossil evidence that the African rock rabbits (Pronolagus) are outside of the main leporid stock and that leporids experienced a rapid radiation. However, the molecular data suggest this radiation event occurred in the mid-Miocene several millions of years earlier that the Pleistocene dates suggested by paleontological evidence.}
}
Matrix 2143 of Study 422

Citation title:
"The utility of cytochrome b and 12S rDNA data for phylogeny reconstruction of leporid (Lagomorpha) genera.".

This study was previously identified under the legacy study ID S373
(Status: Published).
Matrices
Title: Cyt b
Description: Legacy TreeBASE Matrix ID = M512
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Ochotona princeps |
(none)
|
?CCCTAATAAAAATC?TAAACCACTCTTTA |
| Sylvilagus floridanus |
(none)
|
CCCCTATTAAAAATTGTAAACCATTCTCTA |
| Sylvilagus audubonii |
(none)
|
CCTCTACTAAAAATCATCAACCACTCCTTA |
| Sylvilagus aquaticus |
(none)
|
CCTCTAC????AATCGTCAACCACTCTCTA |
| Romerolagus diazi |
(none)
|
?CCCTACTAAAAATTGTTAACCACTCCTTA |
| Pronolagus crassicaudatus |
(none)
|
CCCTTATTTAAAATCTTGAACCACTCCCTA |
| Oryctolagus cuniculus |
(none)
|
CCCCTATTAAAAATTGTTAACCACTCCCTA |
| Lepus capensis |
(none)
|
CCCCTACTAAAAATTGTTAACCACTCCCTA |
| Lepus californicus |
(none)
|
?CCCTACTAAAAATTGTTAACCACTCCCTA |
| Lepus americanus |
(none)
|
CCCCTACTAAAAATTGTTAACCACTCCCTA |
| Bunolagus monticularis |
(none)
|
CCCCTATTAAAAATCATCAATCACTCCCTA |
| Brachylagus idahoensis |
(none)
|
CCCCTGCTAAAAATAGTCAATCACTCTTTA |
Columns
None of the columns has a description.